콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU076001

Sigma-Aldrich

MISSION® esiRNA

targeting human YWHAZ

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 07일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 07일세부사항


설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGAAGCCACAATGTTCTTGGCCCATCATGACATTGGGTAGCATTAACTGTAAGTTTTGTGCTTCCAAATCACTTTTTGGTTTTTAAGAATTTCTTGATACTCTTATAGCCTGCCTTCAATTTTGATCCTTTATTCTTTCTATTTGTCAGGTGCACAAGATTACCTTCCTGTTTTAGCCTTCTGTCTTGTCACCAACCATTCTTACTTGGTGGCCATGTACTTGGAAAAAGGCCGCATGATCTTTCTGGCTCCACTCAGTGTCTAAGGCACCCTGCTTCCTTTGCTTGCATCCCACAGACTATTTCCCTCATCCTATTTACTGCAGCAAATCTCTCCTTAGTTGATGAGACTGTGTTTATCTCCCTTTAAAACCCTACCTATCCTGAATGGTCTGTCATTGTCTGCCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wenrui Wang et al.
Cell death & disease, 8(10), e3071-e3071 (2017-10-06)
MicroRNAs (miRNAs) have been identified as major post-transcriptional regulators of the initiation and progression of human cancers, including breast cancer. However, the detail role of miR-451 has not been fully elucidated in breast cancer. In this study, we aimed to
Lei Yan et al.
Environmental toxicology, 35(9), 1015-1028 (2020-05-19)
Breast cancer (BC) is the leading cause of cancer-related death in women worldwide and one of the most prevalent malignancy. In recent years, increasing evidence had illuminated that long noncoding RNAs (lncRNAs) serve as critical factors in multiple tumor progression
Langyong Mao et al.
American journal of cancer research, 5(6), 1939-1953 (2015-08-14)
The deregulation of microRNAs has been demonstrated in various tumor processes. Here, we report that microRNA-544 (miR-544) is decreased in cervical cancer tissues compared with normal cervical tissues. To identify the mechanisms involved in miR-544 deregulation, we studied the regulation
Jie Shi et al.
Oncology reports, 41(2), 1101-1112 (2018-12-12)
Ovarian cancer is one of the three most deadly gynecological cancers, with the highest mortality rate. As the main cause of death, metastasis is considered to be a crucial factor that reduces the survival time of ovarian carcinoma patients. YWHAZ
Gareth E Lim et al.
Nature communications, 6, 7671-7671 (2015-07-30)
The proteins that coordinate complex adipogenic transcriptional networks are poorly understood. 14-3-3ζ is a molecular adaptor protein that regulates insulin signalling and transcription factor networks. Here we report that 14-3-3ζ-knockout mice are strikingly lean from birth with specific reductions in

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.