콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU074811

Sigma-Aldrich

MISSION® esiRNA

targeting human WHRN

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 07일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 07일세부사항


설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CGAGGCCTTCAAGACTAAGGACCGTGACTACATTGACTTTCTGGTCACTGAGTTCAATGTGATGCTCTAGAGGCCAAGGCCTGAGGGCCTCCCACCACTGCCCAGCCCCTGGTCCCAGTCCCTTTCCACCGTTGGCTTCATCAAGCTCCTTGCGGGGTTGGGGCTGCATGGCCAGGGTGGCAGGAAGACATCCCCCCTCCATCCCAGCCCACTGGACCAGAACTGGGAGAGGAAGAGAGCAGGACAAGGCAGACAGAAGGTCAGGTCAGGAACTGGTGCTGTACTGGGTACACAGTAGGCGCCCAGGACAAGTGGGTTGCAAGACAGGAAGAAAGGAAAAGGAAGGGCAGAGTGCTGGTTTCTCCAGGTTGGGTTGGGGGCACTGCTGTCCCCCCTCCAGCTAGGACCCAGCCCATCCCCAGATGCCTGAGCCTTTGTCCAAAGTGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Fernanda C Teixeira et al.
Pharmaceutical development and technology, 25(4), 408-415 (2019-12-19)
Introduction: Glioblastoma (GB) is the most common malignant brain tumor and is characterized by high invasiveness, poor prognosis, and limited therapeutic options. Silencing gene expression, through the use of small interfering RNA (siRNA), has been proposed as an alternative to
Wuming Gong et al.
BMC bioinformatics, 7, 516-516 (2006-11-30)
Short interfering RNAs have allowed the development of clean and easily regulated methods for disruption of gene expression. However, while these methods continue to grow in popularity, designing effective siRNA experiments can be challenging. The various existing siRNA design guidelines
Avraam El Hamidieh et al.
PloS one, 7(8), e42722-e42722 (2012-08-23)
Cdc37 is a 50 kDa molecular chaperone which targets intrinsically unstable protein kinases to the molecular chaperone HSP90. It is also an over-expressed oncoprotein that mediates carcinogenesis and maintenance of the malignant phenotype by stabilizing the compromised structures of mutant
Shun Yao et al.
Cancer letters, 502, 1-8 (2020-12-07)
Angio-associated migratory cell protein (AAMP) is considered a pro-tumor protein, which contributes to angiogenesis, proliferation, adhesion, and other biological activities. Although AAMP is known to facilitate the motility of breast cancer cells and smooth muscle cells by regulating ras homolog
Ya-Jie Zhang et al.
World journal of gastroenterology, 20(25), 8229-8236 (2014-07-11)
To investigate the effect of Girdin knockdown on the chemosensitivity of colorectal cancer cells to oxaliplatin and the possible mechanisms involved. Four siRNAs targeting Girdin were transfected into the chemoresistant colorectal cancer cell line DLD1. Real-time polymerase chain reaction (PCR)

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.