콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU074691

Sigma-Aldrich

MISSION® esiRNA

targeting human GABPA

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484

예상 입고일2025년 5월 15일세부사항

모든 사진(1)

크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484

예상 입고일2025년 5월 15일세부사항

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCAGAGTGCACAGAAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAACCAATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGTCTGCAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAACCTGCGGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTTGAAGAAGCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAACAAGTGACAAGATGGGCTGCT

Ensembl | 인체 수납 번호

ENSG00000154727

NCBI 수납 번호

NM_002040

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... GABPA(2551) , GABPA(2551)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ABZO
BWU
SXT
QCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Limin Xu et al.
Frontiers in cell and developmental biology, 8, 569977-569977 (2020-10-31)
Cerebral ischemic injury is a complicated pathological process. Adipose-derived stromal cells (ADSCs) have been used as a therapeutic strategy, with their therapeutic effects chiefly attributed to paracrine action rather than trans-differentiation. Studies have shown that circAkap7 was found to be
Lu Gao et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(10), 3322-3338 (2018-07-22)
Diabetes contributes to cardiovascular complications and the pathogenesis of cardiac remodeling that can lead to heart failure. We aimed to evaluate the functional role of LAZ3 in diabetic cardiomyopathy (DCM). Streptozotocin (STZ) was used to induce a diabetic mouse model.
Jeong Il Yu et al.
Scientific reports, 7(1), 14986-14986 (2017-11-10)
Although efficacy of combined histone deacetylase (HDAC) inhibitors and conventional photon radiotherapy is being tested in clinical trials, their combined effect with proton beam radiotherapy has yet to be determined. Here, we compared combined effect of valproic acid (VPA), a
Valia T Mihaylova et al.
Cell reports, 24(11), 3000-3007 (2018-09-13)
Rhinovirus is a leading cause of acute respiratory infections and asthma attacks, but infections are also frequently cleared from the nasal mucosa without causing symptoms. We sought to better understand host defense against rhinovirus by investigating antiviral defense in primary
Renzhe Cui et al.
Ophthalmic research, 63(4), 404-412 (2019-12-23)
Oxidative damage plays a vital role in the pathogenesis of age-related macular degeneration (AMD). Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, possesses several pharmacological functions, such as anti-inflammatory and antioxidative properties. However, the effects and mechanism of EX4 on oxidative
모든 관련된 서류 보기

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.