설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCAGCCCCTCAGAGAATGATCACCCTGAATTCATTGTCTCAGTGAAGGAAGAACCTGTAGAAGATGACCTCGTTCCGGAGCTGGGTATCTCAAATCTGCTTTCATCCAGCCACTGCCCAAAGCCATCTTCCTGCCTACTGGATGCTTACAGTGACTGTGGATACGGGGGTTCCCTTTCCCCATTCAGTGACATGTCCTCTCTGCTTGGTGTAAACCATTCTTGGGAGGACACTTTTGCCAATGAACTCTTTCCCCAGCTGATTAGTGTCTAAGGAATGATCCAATACTGTTGCCCTTTTCCTTGACTATTACACTGCCTGGAGGATAGCAGAGAAGCCTGTCTGTACTTCATTCAAAAAGCCAAAATAGAGAGTATACAGTCCTAGAGAATTCCTCTATTTGTTCAGATCTCATAGATGACCCCCAGGTATTGTCTTTTGACATCCAGCAGTCCAAGGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... XBP1(7494) , XBP1(7494)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
A-F Song et al.
European review for medical and pharmacological sciences, 24(22), 11675-11682 (2020-12-05)
Rheumatoid arthritis (RA) is an autoimmune, inflammatory disease mainly manifested by joint damage. Its mechanism is not completely clear at present. Previous studies have found that microRNA-34a-5p (miR-34a-5p) is involved in the development of many inflammatory diseases. In this study
Yukako Tokutake et al.
International journal of molecular sciences, 21(1) (2020-01-01)
In skeletal muscle, myoblast differentiation results in the formation of multinucleated myofibers. Although recent studies have shown that unfolded protein responses (UPRs) play an important role in intracellular remodeling and contribute to skeletal muscle differentiation, the involvement of IRE1-XBP1 signaling
Joshua M Royal et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 13527-13545 (2019-09-29)
Cholera toxin B subunit (CTB) exhibits broad-spectrum biologic activity upon mucosal administration. Here, we found that a recombinant CTB containing an endoplasmic reticulum (ER) retention motif (CTB-KDEL) induces colon epithelial wound healing in colitis via the activation of an unfolded
Jia-Rong Jheng et al.
Journal of cachexia, sarcopenia and muscle, 9(3), 570-584 (2018-01-31)
Sarcopenia is the age-related degeneration characterized with the decline of skeletal muscle mass, strength, and function. The imbalance of protein synthesis and degradation which jeopardizes immune, hormone regulation, and muscle-motor neuron connection is the main cause of sarcopenia. There is
Akihiro Kishino et al.
Scientific reports, 7(1), 4442-4442 (2017-07-02)
The purpose of this study was to clarify the relationship among X-box-binding protein 1 unspliced, spliced (XBP1u, s), Forkhead box O1 (FoxO1) and autophagy in the auditory cells under endoplasmic reticulum (ER) stress. In addition, the relationship between ER stress
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
