설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGTGTAGCTCCAGCACTCGGTCAGTGTTGAAGAGACCAGAACGATCTCAAGAGGAGTCTCCACCTGGAAGTACAAAGAGGAGGAAGAGCATGTCTGGGGCCAGCCCCAAAGAGTCAACTAATCCAGAGAAGGCCCATGAGACTCTTCATCAGTCTTTATCCCTGGCATCTTCCCCCAAAGGAACCATTGAGAACATTTTGGACAATGACCCAAGGGACCTTATAGGAGACTTCTCCAAGGGTTATCTCTTTCATACAGTTGCTGGGAAACATCAGGATTTAAAATACATCTCTCCAGAAATTATGGCATCTGTTTTGAATGGCAAGTTTGCCAACCTCATTAAAGAGTTTGTTATCATCGACTGTCGATACCCATATGAATACGAGGGAGGCCACATCAAGGGTGCAGTGAACTTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CDC25A(993) , CDC25A(993)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Wenzhe Yin et al.
OncoTargets and therapy, 13, 3689-3701 (2020-05-21)
Colorectal cancer (CRC) is a common malignant tumor in digestive system. Circular RNA (circRNA) circ_0007142 has been identified as an oncogene in CRC. However, the mechanism of circ_0007142 in CRC was rarely reported. The levels of circ_0007142, dedicator of cytokinesis
Xiao Gao et al.
Nature communications, 11(1), 3904-3904 (2020-08-09)
A major challenge in chemotherapy is chemotherapy resistance in cells lacking p53. Here we demonstrate that NIP30, an inhibitor of the oncogenic REGγ-proteasome, attenuates cancer cell growth and sensitizes p53-compromised cells to chemotherapeutic agents. NIP30 acts by binding to REGγ
Yanchao Ma et al.
Journal of Cancer, 11(8), 2158-2170 (2020-03-05)
Colorectal cancer (CRC) is one of the most common malignancies, and chemoresistance is one of the key obstacles in the clinical outcome. Here, we studied the function of B7-H3 in regulating cell cycle-mediated chemoresistance in CRC. The ability of B7-H3
Sarah Bertoli et al.
Oncotarget, 6(35), 38061-38078 (2015-10-31)
We investigated cell cycle regulation in acute myeloid leukemia cells expressing the FLT3-ITD mutated tyrosine kinase receptor, an underexplored field in this disease. Upon FLT3 inhibition, CDC25A mRNA and protein were rapidly down-regulated, while levels of other cell cycle proteins
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
