콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU058911

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD8

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51
가격 및 재고 정보를 현재 이용할 수 없음

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAACCTCCTGTGAGCGAGAGTGATGATGGCTTCAGCATACACAATGCTACACTGCAGTCACACACACTGGCAGACTCCATCCCCAGCAGCCCTGCTTCTTCACAGTTCTCTGTCTGTAGTGAGGATCAGGAAGCTATTCAGGCACAGAAAATTTGGAAGAAAGCCATCATGCTTGTATGGAGAGCTGCAGCTAATCATAGGTATGCCAATGTCTTCCTGCAGCCTGTTACAGATGACATAGCACCTGGCTACCACAGCATTGTGCAGAGGCCTATGGATTTGTCAACTATTAAGAAAAACATAGAAAATGGACTGATCCGAAGCACAGCTGAATTTCAGCGTGACATTATGCTGATGTTTCAGAATGCTGTAATGTACAATAGCTCAGACCATGATGTCTATCACATGGCAGTGGAGATG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Anahita Lashgari et al.
Scientific reports, 8(1), 14089-14089 (2018-09-22)
Regulation of the chromatin state is crucial for biological processes such as the regulation of transcription, DNA replication, and DNA damage repair. Here we show that knockdown of the BRD8 bromodomain protein - a subunit of the p400/Tip60 complex -
Zhaoxiang Yu et al.
Archives of biochemistry and biophysics, 693, 108550-108550 (2020-08-30)
Bromodomain-containing 8 (BRD8), which belongs to the histone acetyl transferase (HAT) complex, functions as a driver in colorectal cancer. However, the role of BRD8 and its related regulatory mechanisms in hepatocellular carcinoma (HCC) remain unexplored. In this study, we found
Changping Gu et al.
Respiratory research, 16, 58-58 (2015-05-20)
Ventilator-induced lung injury (VILI) is one of the most common complications for patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Although p120 is an important protein in the regulation of cell junctions, further mechanisms should be
Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.