콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU055781

Sigma-Aldrich

MISSION® esiRNA

targeting human LATS2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGTGCCTTGCTTGTAAGGTGGACACTCACGCCCTGTACGCCATGAAGACCCTAAGGAAAAAGGATGTCCTGAACCGGAATCAGGTGGCCCACGTCAAGGCCGAGAGGGACATCCTGGCCGAGGCAGACAATGAGTGGGTGGTCAAACTCTACTACTCCTTCCAAGACAAAGACAGCCTGTACTTTGTGATGGACTACATCCCTGGTGGGGACATGATGAGCCTGCTGATCCGGATGGAGGTCTTCCCTGAGCACCTGGCCCGGTTCTACATCGCAGAGCTGACTTTGGCCATTGAGAGTGTCCACAAGATGGGCTTCATCCACCGAGACATCAAGCCTGATAACATTTTGATAGATCTGGATGGTCACATTAAACTCACAGATTTCGGCCTCTGCACTGGGTTCAGGTGGACTCACAATTCCAAATATTACCAGAAAGGGAGCCATG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Cédric Belair et al.
Silence, 2(1), 7-7 (2011-10-27)
MicroRNAs, post-transcriptional regulators of eukaryotic gene expression, are implicated in host defense against pathogens. Viruses and bacteria have evolved strategies that suppress microRNA functions, resulting in a sustainable infection. In this work we report that Helicobacter pylori, a human stomach-colonizing
Ke Wang et al.
International journal of molecular medicine, 47(4) (2021-02-13)
Long non‑coding RNAs (lncRNAs) are a class of non‑protein coding transcripts that are involved in the regulation of gene expression in mammalian cells. Transcriptional co‑activator Yes associated protein 1 (YAP1) plays a key role in the progression of ovarian cancer.
Cong Dong et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 44(6), 475-481 (2015-03-19)
Many reports indicated LATS2 was a component of the Hippo pathway, could phosphorylate and inactivate YAP, acted as a tumor suppressor in human cancers. But few studies investigated the role of LATS2 in oral squamous cell carcinoma (OSCC) and clarified
Tone B Enger et al.
Laboratory investigation; a journal of technical methods and pathology, 93(11), 1203-1218 (2013-10-02)
Sjogren's syndrome (SS) is a complex autoimmune disease that primarily affects salivary and lacrimal glands and is associated with high morbidity. Although the prevailing dogma is that immune system pathology drives SS, increasing evidence points to structural defects, including defective
Peng Zhang et al.
Cell discovery, 2, 16021-16021 (2016-07-28)
Partitioning-defective 3 (Par3), a key component of the evolutionarily conserved polarity PAR complex (Par3/Par6/aPKC), controls cell polarity and contributes to cell migration, proliferation and tumor development. Emerging evidence indicates that cell polarity proteins function as upstream modulators that regulate the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.