콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU053891

Sigma-Aldrich

MISSION® esiRNA

targeting human TET1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AAAAGACCTCCAAGACCCAAACTTACAGGGAGAGCCACCAAAACTTAATCACTGTCCATCTTTGGAAAAACAAAGTTCATGCAACACGGTGGTTTTCAATGGGCAAACTACTACCCTTTCCAACTCACATATCAACTCAGCTACTAACCAAGCATCCACAAAGTCACATGAATATTCAAAAGTCACAAATTCATTATCTCTTTTTATACCAAAATCAAATTCATCCAAGATTGACACCAATAAAAGTATTGCTCAAGGGATAATTACTCTTGACAATTGTTCCAATGATTTGCATCAGTTGCCACCAAGAAATAATGAAGTGGAGTATTGCAACCAGTTACTGGACAGCAGCAAAAAATTGGACTCAGATGATCTATCATGTCAGGATGCAACCCATACC

Ensembl | 인체 수납 번호

ENSG00000138336

NCBI 수납 번호

NM_030625

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TET1(80312) , TET1(80312)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
NAV
XQU
WSS
ZQS
BQS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Li Gao et al.
International journal of biological sciences, 16(8), 1324-1334 (2020-03-27)
Myostatin (MSTN) is mostly expressed in skeletal muscle and plays crucial roles in the negative regulation of muscle mass development. The methylation and demethylation of myogenesis-specific genes are major regulatory factors in muscle satellite cell differentiation. The present study was
Piotr T Filipczak et al.
Cancer research, 79(8), 1758-1768 (2019-01-10)
The role of transcriptional regulator ten-eleven translocation methylcytosine dioxygenease 1 (TET1) has not been well characterized in lung cancer. Here we show that TET1 is overexpressed in adenocarcinoma and squamous cell carcinomas. TET1 knockdown reduced cell growth in vitro and
Xiaoli Peng et al.
BMC cancer, 17(1), 619-619 (2017-09-06)
Breast cancer is the common cancer in China. In previous study, we determined that 3,6-dihydroxyflavone (3,6-DHF) increases miR-34a significantly in breast carcinogenesis, but the mechanism remains unclear. We used qRT-PCR to analyze miR-34a and ten-eleven translocation (TET)1, TET2, TET3 levels
Pankaj Prasad et al.
Stem cells (Dayton, Ohio), 35(6), 1468-1478 (2017-04-05)
Activation of pluripotency regulatory circuit is an important event in solid tumor progression and the hypoxic microenvironment is known to enhance the stemness feature of some cells. The distinct population of cancer stem cells (CSCs)/tumor initiating cells exist in a
Chuanxu Wang et al.
Cancer medicine, 8(3), 990-1003 (2019-02-21)
Increasing evidence revealed that ten-eleven translocation 1 (TET1) plays an important role in tumorigenesis and chemoresistance, but its functions in gemcitabine resistance in cholangiocarcinoma (CCA) remain unknown. This study aims to investigate the effect of TET1 on gemcitabine resistance in
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.