콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU024791

Sigma-Aldrich

MISSION® esiRNA

targeting human TET2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGCAGCAGCCAATAGGACATGATCCAGGAAGAGCAGTAAGGGACTGAGCTGCTGAATTCAACTAGAGGGCAGCCTTGTGGATGGCCCCGAAGCAAGCCTGATGGAACAGGATAGAACCAACCATGTTGAGGGCAACAGACTAAGTCCATTCCTGATACCATCACCTCCCATTTGCCAGACAGAACCTCTGGCTACAAAGCTCCAGAATGGAAGCCCACTGCCTGAGAGAGCTCATCCAGAAGTAAATGGAGACACCAAGTGGCACTCTTTCAAAAGTTATTATGGAATACCCTGTATGAAGGGAAGCCAGAATAGTCGTGTGAGTCCTGACTTTACACAAGAAAGTAGAGGGTATTCCAAGTGTTTGCAAAATGGAGGAATAAAACGCACAGTTAGTGAACCTTCTCTCTCTGGGCTCC

Ensembl | 인체 수납 번호

ENSG00000168769

NCBI 수납 번호

NM_017628

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TET2(54790) , TET2(54790)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Elena F M Manzoni et al.
Scientific reports, 6, 37017-37017 (2016-11-15)
Phenotype definition is controlled by epigenetic regulations that allow cells to acquire their differentiated state. The process is reversible and attractive for therapeutic intervention and for the reactivation of hypermethylated pluripotency genes that facilitate transition to a higher plasticity state.
Juan Peng et al.
Frontiers in pharmacology, 8, 486-486 (2017-08-12)
Ten-eleven translocation-2 (TET2) protein is a DNA demethylase that regulates gene expression through DNA demethylation and also plays important roles in various diseases including atherosclerosis. Endothelial dysfunction represents an early key event in atherosclerotic disease. The cystathionine-γ-lyase (CSE)/hydrogen sulfide (H
Juan Peng et al.
Oncotarget, 7(47), 76423-76436 (2016-11-09)
Tet methylcytosine dioxygenase 2 (TET2) mediates the conversion of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC). The loss of TET2 is associated with advanced atherosclerotic lesions. Our previous study showed that TET2 improves endothelial cell function by enhancing endothelial cell autophagy. Accordingly
Zhaocai He et al.
American journal of translational research, 10(10), 3211-3223 (2018-11-13)
To explore the effect of fetal-lethal non-coding developmental regulatory RNA (FENDRR) in the initiation and progression of gastric cancer (GC). We detected the levels of FENDRR, microRNA-214-3p (miR-214-3p), and ten-eleven-translocation (TET2) in GC tissues and GC cell lines. In addition
Peter A Mollica et al.
Journal of cell science, 131(13) (2018-06-15)
Huntington's disease (HD) is a rare autosomal dominant neurodegenerative disorder caused by a cytosine-adenine-guanine (CAG) trinucleotide repeat (TNR) expansion within the HTT gene. The mechanisms underlying HD-associated cellular dysfunction in pluripotency and neurodevelopment are poorly understood. We had previously identified
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.