콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU052901

Sigma-Aldrich

MISSION® esiRNA

targeting human GDF15

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GAGGTGCAAGTGACCATGTGCATCGGCGCGTGCCCGAGCCAGTTCCGGGCGGCAAACATGCACGCGCAGATCAAGACGAGCCTGCACCGCCTGAAGCCCGACACGGTGCCAGCGCCCTGCTGCGTGCCCGCCAGCTACAATCCCATGGTGCTCATTCAAAAGACCGACACCGGGGTGTCGCTCCAGACCTATGATGACTTGTTAGCCAAAGACTGCCACTGCATATGAGCAGTCCTGGTCCTTCCACTGTGCACCTGCGCGGAGGACGCGACCTCAGTTGTCCTGCCCTGTGGAATGGGCTCAAGGTTCCTGAGACACCCGATTCCTGCCCAAACAGCTGTATTTATATAAGTCTGTTATTTATTATTAATTTATTGGGGTGACCTTCTTGGGGACTCGG

Ensembl | 인체 수납 번호

ENSG00000130513

NCBI 수납 번호

NM_004864

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... GDF15(9518) , GDF15(9518)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yixin Zhang et al.
Oncotarget, 8(22), 36531-36544 (2017-04-08)
Ischemia reperfusion (I/R) injury which inevitably occurs during heart transplantation is the major factor leading to organ failure and graft rejection. In order to develop new therapies to prevent I/R injury, we used both a murine heart transplantation model with
Maria Louca et al.
Cancers, 11(8) (2019-08-16)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor due to its invasive phenotype. Ras suppressor 1 (RSU-1) is a cell-extracellular matrix adhesion protein and we recently found that it promotes cell invasion in aggressive cells and inhibits
Yanwei Lu et al.
Cell death & disease, 8(9), e3036-e3036 (2017-09-08)
CDP138, a CDK5 binding partner, regulates cell proliferation and migration. However, the mechanisms by which CDP138 functions in these processes remain unclear. In this study, we show that CDP138 is frequently overexpressed and that high levels of CDP138 are correlated
Kathrin Ackermann et al.
Atherosclerosis, 281, 128-136 (2019-01-19)
Growth differentiation factor-15 (GDF-15)/macrophage inhibitory cytokine-1 (MIC-1/GDF15) is associated with cardiovascular disease, inflammation and development of atherosclerosis and is highly expressed in macrophages (MΦ) of atherosclerotic lesions. Thus, we were interested in investigating the influence of GDF-15 in lipid homeostasis
Liang Chen et al.
Biochemical and biophysical research communications, 526(2), 293-299 (2020-03-27)
Ferroptosis is an iron-dependent form of regulated cell death. GDF15 affects various properties of cancer cells, but the role of GDF15 in ferroptosis has not been reported. In the present study, we found that GDF15 knockdown led to decreased expression
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.