콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU050311

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGS2

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 09일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 09일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGCGGGAACACAACAGAGTATGCGATGTGCTTAAACAGGAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTAATACTGATAGGAGAGACTATTAAGATTGTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAACTGAAATTTGACCCAGAACTACTTTTCAACAAACAATTCCAGTACCAAAATCGTATTGCTGCTGAATTTAACACCCTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCATGACCAGAAATACAACTATCAACAGTTTATCTACAACAACTCTATATTGCTGGAACATGGAATTACCCAGTTTGTTGAATCATTCACCAGGCAAATTGCTGGCAGGGTTGCTGGTGGTAGGAATG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sreekanth Chanickal Narayanapillai et al.
Carcinogenesis, 41(11), 1518-1528 (2020-07-01)
Chronic obstructive pulmonary disease (COPD) is a significant risk factor for lung cancer. One potential mechanism through which COPD contributes to lung cancer development could be through generation of an immunosuppressive microenvironment that allows tumor formation and progression. In this
Ke Liao et al.
Journal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology, 15(3), 390-399 (2019-07-22)
Long non-coding RNAs (lncRNAs), including long intergenic non-coding RNAs (lincRNAs), play an important regulatory role in controlling various biological processes. Both in vitro and in vivo studies have demonstrated that lincRNA-Cox2 plays a global regulatory role in regulating the expression
Mia Madel Alfajaro et al.
PloS one, 13(7), e0200726-e0200726 (2018-07-19)
Cyclooxygenases (COXs)/prostaglandin E2 (PGE2) signaling pathways are known to modulate a variety of homeostatic processes and are involved in various pathophysiological conditions. COXs/PGE2 signaling pathways have also been demonstrated to have proviral or antiviral effects, which appeared different even in
Denise Philipp et al.
Stem cell research & therapy, 9(1), 286-286 (2018-10-26)
During the last decade, mesenchymal stem cells (MSCs) have gained much attention in the field of regenerative medicine due to their capacity to differentiate into different cell types and to promote immunosuppressive effects. However, the underlying mechanism of MSC-mediated immunoregulation
Bing-Wei Dong et al.
Biochemical and biophysical research communications, 503(4), 2293-2300 (2018-07-03)
Cisplatin (CDDP)-based systematic chemotherapy remains the mainstay of treatment for muscle-invasive bladder cancer (MIBC). However, acquired resistance to CDDP, a multifactorial process governed by an array of signals acting at different levels, is the major problem in BC treatment. Here

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.