설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAAAATCTTTCCCCCACCTCTTCCCAAATGATTCAGCAGTCTCATGATAATCCAAGTAACTCTCTGTGTGAAGCACCTTTGAACATTTCACGTGATACTTTGTGTTCAGATGAATACTTTGCTGGTGGCTTACACTCATCTTTTGATGATCTTTGTGGAAACTCAGGATGTGGAAATCAGGAAAGGAAGTTGGAAGGATCCATTAATGACATTAAAAGTGATGTGTGTATTTCTTCACTTGTATTGAAAGCAAATAATATTCATTCATCACCATCTTTCACTCACCTCGATAAATCAAGTCCTCAGAAATTTCTGAGTAATCTTTCAAAGGAAGAAATAAACTTGCAAAGAAATATTGCAGGTAAAGTAGTCACCCCTGACCAAAAGCAGGCTGCAGGTATGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MCPH1(79648) , MCPH1(79648)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
María Arroyo et al.
Genes, 11(4) (2020-04-12)
The capacity of Topoisomerase II (Topo II) to remove DNA catenations that arise after replication is essential to ensure faithful chromosome segregation. Topo II activity is monitored during G2 by a specific checkpoint pathway that delays entry into mitosis until
Alessandro Cicconi et al.
Nature communications, 11(1), 5861-5861 (2020-11-19)
Telomeres protect chromosome ends from inappropriately activating the DNA damage and repair responses. Primary microcephaly is a key clinical feature of several human telomere disorder syndromes, but how microcephaly is linked to dysfunctional telomeres is not known. Here, we show
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
