콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU045261

Sigma-Aldrich

MISSION® esiRNA

targeting human SPRY2

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 26일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 26일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGAGCTTAAGCCACTGAGCAAGGAAGATTTGGGCCTGCACGCCTACAGGTGTGAGGACTGTGGCAAGTGCAAATGTAAGGAGTGCACCTACCCAAGGCCTCTGCCATCAGACTGGATCTGCGACAAGCAGTGCCTTTGCTCGGCCCAGAACGTGATTGACTATGGGACTTGTGTATGCTGTGTGAAAGGTCTCTTCTATCACTGTTCTAATGATGATGAGGACAACTGTGCTGACAACCCATGTTCTTGCAGCCAGTCTCACTGTTGTACACGATGGTCAGCCATGGGTGTCATGTCCCTCTTTTTGCCTTGTTTATGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGGTGTTATGACCGGGTTAACAGGCCTGGTTGCCGCTGTAAAAACTC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jun-Ho Ahn et al.
Biomolecules & therapeutics, 23(4), 320-326 (2015-07-15)
The clinical benefits of oncogenic BRAF inhibitor therapies are limited by the emergence of drug resistance. In this study, we investigated the role of a negative regulator of the MAPK pathway, Spry2, in acquired resistance using BRAF inhibitor-resistant derivatives of
Yan Liu et al.
Molecular medicine reports, 23(5) (2021-03-25)
Age-related cataract (ARC) is the primary cause of blindness worldwide. Abnormal expression of microRNAs (miRNAs/miRs) has been reported to be associated with multiple diseases, including ARC. However, the potential role of miR-124 in ARC remains unclear. The present study used
Evan K Day et al.
Cell reports, 30(10), 3383-3396 (2020-03-12)
SPRY2 is a purported tumor suppressor in certain cancers that promotes tumor growth and resistance to receptor tyrosine kinase inhibitors in glioblastoma. Here, we identify a SPRY2-dependent bypass signaling mechanism in glioblastoma that drives resistance to EGFR and MET inhibition.
Tatiana Lopatina et al.
Oncogenesis, 9(10), 90-90 (2020-10-12)
The lack of approved targeted therapies highlights the need for new treatments for triple-negative breast cancer (TNBC) patients. Interleukin-3 (IL-3) acts as an autocrine factor for tumor-endothelial cells (TEC), and exerts pro-angiogenic paracrine action via extracellular vesicles (EVs). IL-3Rα blockade

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.