설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCTTTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAACGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAATGAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAAATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAGTTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGATTTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PIK3C3(5289) , PIK3C3(5289)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Pierre-Luc Mouchel et al.
Cancers, 12(10) (2020-10-16)
Dendrogenin A (DDA), a mammalian cholesterol metabolite with tumor suppressor properties, has recently been shown to exhibit strong anti-leukemic activity in acute myeloid leukemia (AML) cells by triggering lethal autophagy. Here, we demonstrated that DDA synergistically enhanced the toxicity of
María Cecilia Gimenez et al.
Journal of virology, 95(6) (2020-12-29)
Infectious bursal disease virus (IBDV) is the archetypal member of the family Birnaviridae and the etiological agent of Gumboro disease, a highly contagious immunosuppressive infection of concern to the global poultry sector for its adverse health effects in chicks. Unlike
Jian-Kang Chen et al.
The Journal of clinical investigation, 125(6), 2429-2444 (2015-05-20)
Kidney size adaptively increases as mammals grow and in response to the loss of 1 kidney. It is not clear how kidneys size themselves or if the processes that adapt kidney mass to lean body mass also mediate renal hypertrophy
Harilaos Filippakis et al.
Scientific reports, 8(1), 14161-14161 (2018-09-23)
Tuberous Sclerosis Complex (TSC), a rare genetic disorder with mechanistic target of rapamycin complex 1 (mTORC1) hyperactivation, is characterized by multi-organ hamartomatous benign tumors including brain, skin, kidney, and lung (Lymphangioleiomyomatosis). mTORC1 hyperactivation drives metabolic reprogramming including glucose and glutamine
Asma Boukhalfa et al.
Nature communications, 11(1), 294-294 (2020-01-17)
Cells subjected to stress situations mobilize specific membranes and proteins to initiate autophagy. Phosphatidylinositol-3-phosphate (PI3P), a crucial lipid in membrane dynamics, is known to be essential in this context. In addition to nutriments deprivation, autophagy is also triggered by fluid-flow
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
