콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU042081

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKAA2

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


예상 입고일2025년 5월 29일세부사항



크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


예상 입고일2025년 5월 29일세부사항


설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCAGATTCTGTCTGCTGTGGATTACTGTCATAGGCATATGGTTGTTCATCGAGACCTGAAACCAGAGAATGTCCTGTTGGATGCACACATGAATGCCAAGATAGCCGATTTCGGATTATCTAATATGATGTCAGATGGTGAATTTCTGAGAACTAGTTGCGGATCTCCAAATTATGCAGCACCTGAAGTCATCTCAGGCAGATTGTATGCAGGTCCTGAAGTTGATATCTGGAGCTGTGGTGTTATCTTGTATGCTCTTCTTTGTGGCACCCTCCCATTTGATGATGAGCATGTACCTACGTTATTTAAGAAGATCCGAGGGGGTGTCTTTTATATCCCAGAATATCTCAATCGTTCTGTCGCCACTCTCCTGATGCATATGCTGCAGGTTGACCCACTGAAACGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Lin Lin et al.
Frontiers in pharmacology, 10, 1617-1617 (2020-02-13)
The increase of blood pressure accelerates endothelial progenitor cells (EPCs) senescence, hence a significant reduction in the number of EPCs is common in patients with hypertension. Autophagy is a defense and stress regulation mechanism to assist cell homeostasis and organelle
Meera Saxena et al.
Journal of cell science, 131(14) (2018-06-29)
The developmental programme of epithelial-mesenchymal transition (EMT), involving loss of epithelial and acquisition of mesenchymal properties, plays an important role in the invasion-metastasis cascade of cancer cells. In the present study, we show that activation of AMP-activated protein kinase (AMPK)
Wei-Wen Su et al.
International journal of medical sciences, 17(5), 678-684 (2020-03-27)
Background: Adenine exhibits potential anticancer activity against several types of malignancies. However, whether adenine has anticancer effects on hepatocellular carcinoma (HCC) cells is incompletely explored. Methods: Human HCC cell lines HepG2 and SK-Hep-1 (p53-wild type) and Hep3B (p53-deficient) were used
Yingshuai Zhao et al.
Cardiology, 143(1), 1-10 (2019-07-16)
The aberrant proliferation and migration of vascular smooth muscle cells (VSMCs) in the vascular wall are crucial pathological events involved in cardiovascular impairments including hypertension, heart failure, and atherosclerosis. At the molecular level, the mammalian target of rapamycin (mTOR)-ribosomal protein
Hua Yu et al.
International journal of oncology, 50(1), 161-172 (2016-12-07)
Caulerpin, a secondary metabolite from the marine invasive green algae Caulerpa cylindracea is known to induce mitochondrial dysfunctions. In this study, the anticancer property of caulerpin was assessed in a panel of colorectal cancer cell lines. We demonstrated that caulerpin

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.