콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU039071

Sigma-Aldrich

MISSION® esiRNA

targeting human AHR, RP11-507K12.1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTTCCAAGCGGCATAGAGACCGACTTAATACAGAGTTGGACCGTTTGGCTAGCCTGCTGCCTTTCCCACAAGATGTTATTAATAAGTTGGACAAACTTTCAGTTCTTAGGCTCAGCGTCAGTTACCTGAGAGCCAAGAGCTTCTTTGATGTTGCATTAAAATCCTCCCCTACTGAAAGAAACGGAGGCCAGGATAACTGTAGAGCAGCAAATTTCAGAGAAGGCCTGAACTTACAAGAAGGAGAATTCTTATTACAGGCTCTGAATGGCTTTGTATTAGTTGTCACTACAGATGCTTTGGTCTTTTATGCTTCTTCTACTATACAAGATTATCTAGGGTTTCAGCAGTCTGATGTCATACATCAGAGTGTATATGAACTTATCCATACCGAAGACCGAGCTGAATTTC

Ensembl | 인체 수납 번호

ENSG00000106546

NCBI 수납 번호

NM_001621

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... AHR(196) , AHR(196)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
SPU
UOU
FRS
FQR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Guillaume Lano et al.
International journal of molecular sciences, 21(7) (2020-04-05)
Endogenous agonists of the transcription factor aryl hydrocarbon receptor (AHR) such as the indolic uremic toxin, indoxyl sulfate (IS), accumulate in patients with chronic kidney disease. AHR activation by indolic toxins has prothrombotic effects on the endothelium, especially via tissue
Yaxin Zhang et al.
Biomolecules & therapeutics, 25(2), 202-212 (2016-11-11)
Doxorubicin (DOX) is a highly effective chemotherapeutic agent; however, the dose-dependent cardiotoxicity associated with DOX significantly limits its clinical application. In the present study, we investigated whether Rb1 could prevent DOX-induced apoptosis in H9C2 cells
Sean A Piwarski et al.
Biochemical pharmacology, 174, 113845-113845 (2020-02-08)
The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor. Triple negative breast cancer (TNBC) is the most aggressive breast cancer subtype. TNBC expresses AHR and AHR ligands have anti-cancer activity in TNBC. The aggressiveness of TNBC is due in
Collynn F Woeller et al.
The American journal of pathology, 186(12), 3189-3202 (2016-11-16)
Thyroid eye disease (TED) is a degenerative disease that manifests with detrimental tissue remodeling, myofibroblast accumulation, and scarring in the orbit of affected individuals. Currently, there are no effective therapies for TED that target or prevent the excessive tissue remodeling
J Gilbert et al.
Scientific reports, 10(1), 13978-13978 (2020-08-21)
We report that the naphthalimide analogue 2-(2-aminophenyl)-1H-benzo[de]isoquinoline-1,3(2H)-dione (NAP-6) is a highly potent and selective breast cancer targeting molecule. These effects are mediated via the aryl hydrocarbon receptor (AHR) pathway and the subsequent induction of CYP1 metabolising monooxygenases in breast cancer
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.