설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGCCAATGTGGTGAGAAAGTTTGGTGTCACCGACTTCCCCTCTTGCTACCTGCTGTTCCGGAATGGCTCTGTCTCCCGAGTCCCCGTGCTCATGGAATCCAGGTCCTTCTATACCGCTTACCTGCAGAGACTCTCTGGGCTCACCAGGGAGGCTGCCCAGACCACAGTTGCACCAACCACTGCTAACAAGATAGCTCCCACTGTTTGGAAATTGGCAGATCGCTCCAAGATCTACATGGCTGACCTGGAATCTGCACTGCACTACATCCTGCGGATAGAAGTGGGCAGGTTCCCGGTCCTGGAAGGGCAGCGCCTGGTGGCCCTGAAAAAGTTTGTGGCAGTGCTGGCCAAGTATTTCCCTGGCCGGCCCTTAGTCCAGAACTTCCTGCACTCCGTGAATGAATGGCTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... QSOX1(5768) , QSOX1(5768)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yibo Geng et al.
OncoTargets and therapy, 13, 5721-5729 (2020-07-02)
Quiescin sulfhydryl oxidase 1 (QSOX1) involves in the formation of disulfide bonds and participates in the protein folding process. In recent years, accumulating evidences have shown that QSOX1 is a biomarker for tumor development and prognosis. However, the biological function
Nicolas Pernodet et al.
Breast cancer research : BCR, 14(5), R136-R136 (2012-10-27)
The gene quiescin/sulfhydryl oxidase 1, QSOX1, encodes an enzyme directed to the secretory pathway and excreted into the extracellular space. QSOX1 participates in the folding and stability of proteins and thus could regulate the biological activity of its substrates in
Yonggang Ma et al.
Journal of neurotrauma, 36(15), 2337-2347 (2019-01-15)
Ependymal cells (EpCs) are a kind of multi-potent stem cells in the central canal of adult spinal cord, which proliferate following spinal cord injury (SCI). Although they can differentiate into functional neurons in vitro, EpC progeny differentiate mainly into astrocytes
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
