설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAAAGGACGTGATCGTCCAGGACGACGATGTGGACTGCACGCTGGTGGAGAAACGTGTGCTGGCGCTGGGGGGCCGGGGTCCTGGCGGCCGGCCCCACTTCCTCACCCAGCTCCACTCCACCTTCCAGACCCCGGACCGCCTGTATTTCGTGATGGAGTACGTCACCGGGGGAGACTTGATGTACCACATTCAACAGCTGGGCAAGTTTAAGGAGCCCCATGCAGCGTTCTACGCGGCAGAAATCGCTATCGGCCTCTTCTTCCTTCACAATCAGGGCATCATCTACAGGGACCTGAAGCTGGACAATGTGATGCTGGATGCTGAGGGACACATCAAGATCACTGACTTTGGCATGTGTAAGGAGAACGTCTTCCCCGGGACGACAACCCGCACCTTCTGCGGGACCCCGGACTACATAGCCCCGGAGATCATTGCCTACCAGCCCTATGGGAAGTCTGTCGATTGGTGGTCCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PRKCG(5582) , PRKCG(5582)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Juan Carlos Montero et al.
Oncotarget, 7(47), 77937-77949 (2016-10-28)
P-Rex proteins are guanine nucleotide exchange factors (GEFs) that act on the Rho/Rac family of GTP binding proteins. The activity of P-Rex proteins is regulated by several extracellular stimuli. In fact, activation of growth factor receptors has been reported to
Yoon Kyung Choi
Archives of pharmacal research, 40(12), 1433-1442 (2017-10-13)
Treatment of human retinal microvascular endothelial cells (HRMECs) with vascular endothelial growth factor 165 (VEGF
Tianchao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 395-402 (2016-09-27)
Application of general anesthetics may induce neurotoxicity in dorsal root ganglia (DRG) neurons. In this study, we examined the possible protective mechanism and associated signaling pathways of small-molecule glycogen synthase kinase-3 (GSK-3) inhibitor, SB216763, in bupivacaine-injured mouse DRG neurons in
Mi Yeong Kim et al.
Scientific reports, 9(1), 7044-7044 (2019-05-09)
c-Fms is the macrophage colony-stimulating factor (M-CSF) receptor, and intracellular signalling via the M-CSF/c-Fms axis mediates both innate immunity and bone remodelling. M-CSF-induced transient proteolytic degradation of c-Fms modulates various biological functions, and protein kinase C (PKC) signalling is activated
Molly Butts et al.
Nutrients, 11(10) (2019-10-23)
Malnutrition is present in chronic alcoholics. However, how moderate alcohol consumption affects the absorption of nutrients like glutamine has not been investigated. Glutamine, an amino acid, is vital to gastrointestinal health. Glutamine is absorbed via sodium-dependent glutamine co-transport (B0AT1; SLC6A19)
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
