설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTGGTGAAGACCGTGGAGATGCGGGATGGAGAGGTCATTAAGGAGTCCAAGCAGGAGCACAAGGATGTGATGTGAGGCAGGACCCACCTGGTGGCCTCTGCCCCGTCTCATGAGGGGCCCGAGCAGAAGCAGGATAGTTGCTCCGCCTCTGCTGGCACATTTCCCCAGACCTGAGCTCCCCACCACCCCAGCTGCTCCCCTCCCTCCTCTGTCCCTAGGTCAGCTTGCTGCCCTAGGCTCCGTCAGTATCAGGCCTGCCAGACGGCACCCACCCAGCACCCAGCAACTCCAACTAACAAGAAACTCACCCCCAAGGGGCAGTCTGGAGGGGCATGGCCAGCAGCTTGCGTTAGAATGAGGAGGAAGGAGAGAAGGGGAGGAGGGCGGGGGGCACCTACTACATCGCCCTCCACATC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GFAP(2670) , GFAP(2670)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Jong-Hyun Moon et al.
Journal of veterinary science, 16(2), 203-211 (2014-10-02)
In the present study, the use of dogs with experimental autoimmune encephalomyelitis (EAE) as a disease model for necrotizing encephalitis (NE) was assessed. Twelve healthy dogs were included in this study. Canine forebrain tissues (8 g), including white and grey
Se Jeong Lee et al.
BMC cancer, 15, 1011-1011 (2015-12-26)
Glioblastoma multiforme (GBM) is characterized by extensive local invasion, which is in contrast with extremely rare systemic metastasis of GBM. Molecular mechanisms inhibiting systemic metastasis of GBM would be a novel therapeutic candidate for GBM in the brain. Patient-derived GBM
Amy Treadwell et al.
Veterinary ophthalmology, 18(5), 371-380 (2014-09-02)
To characterize the clinical, diagnostic, and histopathologic findings in dogs with canine ocular gliovascular syndrome (COGS). The archives at the Comparative Ocular Pathology Laboratory of Wisconsin (COPLOW) were used to identify eyes with COGS. Histopathological inclusion criteria included: a neovascular
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
