설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGCTGACAGTAGTCGCAAGGAAATTCTCCATTTTCCTAAGGGTGGGGGCTATAGTGTCCTTATTCGAGAGGGACTTACCTGTCCGGTGGGCATAGCCCTAACTCCTAAGGGGCAGCTGCTGGTCTTGGACTGTTGGGATCATTGCATCAAGATCTACAGCTACCATCTGAGAAGATATTCCACCCCATAGGGGATGAGAAATTATCAGTTTCTTCTGCTCCCAAGCCAACTTCCCTTCCCTTAGTTCTTGGTTGTTAGTGGCACATGCAGAATAGACTCAGCCTATGTCCTGATTCCAGCTGGGTAGTTCTAGAACTTCAGAAGCTCCATCTTTTAATGTTTTTATTTGTTATGTCCCCCTCCCCGCTTCCCACCTAAATTTAGAGCTTTAAAAGATGCACTGCCCAAATAGGAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TRIM32(22954) , TRIM32(22954)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Hao Cui et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 801-811 (2017-09-28)
Epithelial cells play important roles as a critical barrier in protecting the cornea from microbial pathogens infection. In this study, we were aiming to investigate the role of E3 ubiquitin ligase tripartite motif protein 32 (TRIM32) in corneal epithelial cells
Sarah Gilbertson et al.
eLife, 7 (2018-10-04)
Alterations in global mRNA decay broadly impact multiple stages of gene expression, although signals that connect these processes are incompletely defined. Here, we used tandem mass tag labeling coupled with mass spectrometry to reveal that changing the mRNA decay landscape
Maria Angeliki S Pavlou et al.
Molecular neurobiology, 54(6), 4257-4270 (2016-06-25)
Alpha-synuclein is an abundant neuronal protein which has been associated with physiological processes like synaptic function, neurogenesis, and neuronal differentiation but also with pathological neurodegeneration. Indeed, alpha-synuclein (snca) is one of the major genes implicated in Parkinson's disease (PD). However
Hideki Izumi et al.
Cancer research, 74(19), 5620-5630 (2014-08-08)
Asymmetric cell division (ACD) is a physiologic process during development and tissue homeostasis. ACD produces two unequal daughter cells: one has stem/progenitor cell activity and the other has potential for differentiation. Recent studies showed that misregulation of the balance between
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
