콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU025951

Sigma-Aldrich

MISSION® esiRNA

targeting human AR

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.


크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GTGGAAGCTGCAAGGTCTTCTTCAAAAGAGCCGCTGAAGGGAAACAGAAGTACCTGTGCGCCAGCAGAAATGATTGCACTATTGATAAATTCCGAAGGAAAAATTGTCCATCTTGTCGTCTTCGGAAATGTTATGAAGCAGGGATGACTCTGGGAGCCCGGAAGCTGAAGAAACTTGGTAATCTGAAACTACAGGAGGAAGGAGAGGCTTCCAGCACCACCAGCCCCACTGAGGAGACAACCCAGAAGCTGACAGTGTCACACATTGAAGGCTATGAATGTCAGCCCATCTTTCTGAATGTCCTGGAAGCCATTGAGCCAGGTGTAGTGTGTGCTGGACACGACAACAACCAGCCCGACTCCTTTGCAGCCTTGCTCTCTAGCCTCAATGAACTGGGAGAGAGACAGCTTGTACACGTGGTCAAGTGGGCCAAGGCCTTGCCTGGCTTCCGCAACTTACACGTGGACGACCAGATGGCTGTCATTCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... AR(367) , AR(367)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chenfei Wang et al.
Nature cell biology, 20(5), 620-631 (2018-04-25)
H3K9me3-dependent heterochromatin is a major barrier of cell fate changes that must be reprogrammed after fertilization. However, the molecular details of these events are lacking in early embryos. Here, we map the genome-wide distribution of H3K9me3 modifications in mouse early
Sekar Natesampillai et al.
Journal of immunology (Baltimore, Md. : 1950), 203(3), 718-724 (2019-06-14)
CD4 T cells from HIV-1 infected patients die at excessive rates compared to those from uninfected patients, causing immunodeficiency. We previously identified a dominant negative ligand that antagonizes the TRAIL-dependent pathway of cell death, which we called TRAILshort. Because the
Nathan R Zemke et al.
Cell host & microbe, 22(6), 789-800 (2017-12-15)
The N-terminal half of adenovirus e1a assembles multimeric complexes with host proteins that repress innate immune responses and force host cells into S-phase. In contrast, the functions of e1a's C-terminal interactions with FOXK, DCAF7, and CtBP are unknown. We found
Vasileios Chortis et al.
Endocrinology, 159(8), 2836-2849 (2018-06-01)
Adrenocortical carcinoma (ACC) is an aggressive malignancy with poor response to chemotherapy. In this study, we evaluated a potential new treatment target for ACC, focusing on the mitochondrial reduced form of NAD phosphate (NADPH) generator nicotinamide nucleotide transhydrogenase (NNT). NNT
Zuzana Krchnáková et al.
Nucleic acids research, 47(2), 911-928 (2018-11-18)
Many nascent long non-coding RNAs (lncRNAs) undergo the same maturation steps as pre-mRNAs of protein-coding genes (PCGs), but they are often poorly spliced. To identify the underlying mechanisms for this phenomenon, we searched for putative splicing inhibitory sequences using the

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.