추천 제품
![7-Chloro-2,3-dihydro-[1,4]dioxino[2,3-b]pyridine-8-carboxylic acid AldrichCPR](/deepweb/assets/sigmaaldrich/product/structures/317/942/685b6210-a988-4c30-abe2-290404b8cdde/640/685b6210-a988-4c30-abe2-290404b8cdde.png)
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGACGTGGCCTATCACTGTTACCCCAACAAGTGTAACGACGATGCCCTGGCCTCTAAGGGAGCTCTGTTTCTCAAGGTGCAGGTGGGAAGCACACCTCAGGACCAAAGAATCGTCGGGTACATCGCCTGCACACACCTGCATGCCCCGCAAGAGGACAGCGCCATCCGGTGTGGGCAGCTGGACCTGCTTCAGGACTGGCTGGCTGATTTCCGAAAATCTACCTCCTCGTCCAGCGCAGCCAACCCCGAGGAGCTGGTGGCATTTGACGTCGTCTGTGGAGATTTCAACTTTGATAACTGCTCCTCTGACGACAAGCTGGAGCAGCAACACTCCCTGTTCACCCACTACAGGGACCCCTGCCGCCTGGGGCCTGGTGAGGAGAAGCCGTGGGCCATCGGTACTCTGCTGGACACGAACG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SMPD3(55512) , SMPD3(55512)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
James Lawson et al.
Oncotarget, 8(48), 83913-83924 (2017-11-16)
Extracellular vesicles (EVs) are key signaling mediators between cancer cells and their supporting stroma, and regulate critical processes such as invasion, metastases, and angiogenesis. We have identified a subset of miRNAs (miR-142-3p, miR-143-3p, miR-145-5p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p, miR-605-5p) that
Kyle I Mentkowski et al.
American journal of physiology. Heart and circulatory physiology, 318(6), H1447-H1460 (2020-04-25)
Macrophages play a pivotal role in tissue repair following myocardial infarction (MI). In response to injury, they exist along a spectrum of activation states tightly regulated by their microenvironment. Cardiosphere-derived cells (CDCs) have been shown to mediate cardioprotection via modulation
Ji Na Kong et al.
International journal of cancer, 137(7), 1610-1620 (2015-04-03)
Many breast cancer cells acquire multidrug resistance (MDR) mediated by ABC transporters such as breast cancer resistance protein (BCRP/ABCG2). Here we show that incubation of human breast cancer MDA-MB-231 cells with farnesoid X receptor antagonist guggulsterone (gug) and retinoid X
Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
