콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU019581

Sigma-Aldrich

MISSION® esiRNA

targeting human TFAP2C

로그인조직 및 계약 가격 보기

크기 선택

20 μG
₩330,484
50 μG
₩589,817

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.


크기 선택

보기 변경
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

₩330,484


구입 가능 여부는 고객센터에 문의하십시오.

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CGCTCCTCAGCTCTACGTCTAAATACAAAGTGACAGTGGCTGAAGTACAGAGGCGACTGTCCCCACCTGAATGCTTAAATGCCTCGTTACTGGGAGGTGTTCTCAGAAGAGCCAAATCGAAAAATGGAGGCCGGTCCTTGCGGGAGAAGTTGGACAAGATTGGGTTGAATCTTCCGGCCGGGAGGCGGAAAGCCGCTCATGTGACTCTCCTGACATCCTTAGTAGAAGGTGAAGCTGTTCATTTGGCTAGGGACTTTGCCTATGTCTGTGAAGCCGAATTTCCTAGTAAACCAGTGGCAGAATATTTAACCAGACCTCATCTTGGAGGACGAAATGAGATGGCAGCTAGGAAGAACATGCTATTGGCGGCCCAGCAACTGTGTAAAGAATTCACAGAACTTCTCAGCCAAGACCGGACACCCCATGGGACCAGCAGGCTCGCCCCAGTCTTGGAGACGAACATACAGAACTGCTTGTCTCATTTCAGCCTGATTACCCACG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

J Kang et al.
Oncogene, 36(11), 1585-1596 (2016-09-07)
Non-small cell lung cancer (NSCLC) remains one of the leading causes of death worldwide, and thus new molecular targets need to be identified to improve treatment efficacy. Although epidermal growth factor receptor (EGFR)/KRAS mutation-driven lung tumorigenesis is well understood, the
Wanyeon Kim et al.
Experimental & molecular medicine, 48(11), e273-e273 (2016-11-26)
TFAP2C (transcription factor-activating enhancer-binding protein 2C) expression has been positively correlated with poor prognosis in patients with certain types of cancer, but the mechanisms underlying TFAP2C-mediated tumorigenesis in non-small-cell lung cancer (NSCLC) are still unknown. We previously performed a microarray
Lingjie Li et al.
Cell stem cell, 24(2), 271-284 (2019-01-29)
Tissue development results from lineage-specific transcription factors (TFs) programming a dynamic chromatin landscape through progressive cell fate transitions. Here, we define epigenomic landscape during epidermal differentiation of human pluripotent stem cells (PSCs) and create inference networks that integrate gene expression
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls

질문

후기

평점 값 없음

활성 필터

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.