설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTCCTCCAGCATCCTCTGTTAGCACACTAGTTTTAGCACCAAGACCTAAACCAAGACAACGTTTAACACCTGTAGATAAGAAGGTATCTTTCGTGGATATCATGCCACATCAGAGTGATGTTTCACAAGAAGGCAGTGTAGATGAGGTAAAAGAGAATACTGAGAAAATGCAGCAAGGAAAAGATGATGTGTCTTTACTATCTGAAGGTCAGCTTGCAGAACAAAGCTTGGCATCTTCTGAAGATGAAACAGAAATAACAGAGGACTTGGAACCAGAAGTTGAAGAGGACATGTCAGCTTCTGACAGTGATGACTGTATTATTCCAGGTCCTATCTCCAAGAATATCAAACAGCCATCAGAAAAAATTCGGATTGAGATCATAGCTCTAAGCCTTAATGATTCTCAAGTAACCATGGATGACACTATCCAACGGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... RPGRIP1L(23322) , RPGRIP1L(23322)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yeon Ja Choi et al.
PLoS genetics, 15(1), e1007914-e1007914 (2019-01-29)
Cilia-related proteins are believed to be involved in a broad range of cellular processes. Retinitis pigmentosa GTPase regulator interacting protein 1-like (RPGRIP1L) is a ciliary protein required for ciliogenesis in many cell types, including epidermal keratinocytes. Here we report that
Jayne F Martin Carli et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 3946-3956 (2018-02-22)
Genetic variants within the FTO (α-ketoglutarate-dependent dioxygenase) gene have been strongly associated with a modest increase in adiposity as a result of increased food intake. These risk alleles are associated with decreased expression of both FTO and neighboring RPGRIP1L (retinitis
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
