콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU007471

Sigma-Aldrich

MISSION® esiRNA

targeting human ST6GALNAC5

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TTACTCGCCACAAGATGCTGCAGTTTGATGAGCTCTTCAAGCAGGAGACTGGCAAAGACAGGAAGATATCCAACACTTGGCTCAGCACTGGCTGGTTTACAATGACAATTGCACTGGAGCTCTGTGACAGGATCAATGTTTATGGCATGGTGCCCCCAGACTTCTGCAGGGATCCCAATCACCCTTCAGTACCTTATCATTATTATGAACCTTTTGGACCTGATGAATGTACAATGTACCTCTCCCATGAGCGAGGACGCAAGGGCAGTCATCACCGCTTTATCACAGAGAAACGAGTCTTTAAGAACTGGGCACGGACATTCAATATTCACTTTTTTCAACCAGACTGGAAACCAGAATCACTTGCTATAAATCATCCTGAGAATAAACCTGTGTTCTAAGGAATGAGCATGCCAGACTGTAATCCCAGGTATTCACTGCATCAGACACCGAGACACTGAACTTCCTGAGCCACCAGACAGGAAAGGGTAGCAGAAAACAGCTTCACTCCTCAGGAAGTACCATGGACAGACGCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

생화학적/생리학적 작용

ST6GALNAC5 (α-N-acetylgalactosaminide α-2,6-sialyltransferase 5) participates in the biosynthesis of α-series gangliosides. It is linked with breast cancer metastasis to the brain. ST6GALNAC5 reduces the association between breast cancer cells and human blood brain barrier. Mutations in this gene are associated with coronary artery disease.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

ST6GALNAC5 Expression Decreases the Interactions between Breast Cancer Cells and the Human Blood-Brain Barrier.
Drolez A et al.
International Journal of Molecular Sciences, 17, E1309-E1309 (2016)
Kolsoum InanlooRahatloo et al.
Scientific reports, 4, 3595-3595 (2014-01-09)
We aimed to identify the genetic cause of coronary artery disease (CAD) in an Iranian pedigree. Genetic linkage analysis identified three loci with an LOD score of 2.2. Twelve sequence variations identified by exome sequencing were tested for segregation with

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.