설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGCTTTGAGTTGACCTTTCGTCTGAAGAGAGAAACTGGGGAGTCTGCCCCACCAACATGGCCCGCAGAGTTAATGCAGGGCTTGGCACGATACGTGTTCCAGTCAGAGAACACCTTCTGCAGTGGGGACCATGTGTCCTGGCACAGCCCTTTGGATAACAGTGAGTCAAGAATTCAGCACATGCTGCTGACAGAGGACCCACAGATGCAGCCCGTGCAGACACCCTTTGGGGTAGTTACCTTCCTCCAGATCGTTGGTGTCTGCACTGAAGAGCTACACTCAGCCCAGCAGTGGAACGGGCAGGGCATCCTGGAGCTGCTGCGGACAGTGCCTATTGCTGGCGGCCCCTGGCTGATAACTGACATGCGGAGGGGAGAGACCATATTTGAGATCGATCCACACCTGCAAGAGAGAGTTGACAAAGGCATCGAGACAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SUFU(51684) , SUFU(51684)
관련 카테고리
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yin Peng et al.
Cell cycle (Georgetown, Tex.), 19(20), 2720-2733 (2020-10-06)
The poor prognosis of late gastric carcinomas (GC) underscores the necessity to identify novel biomarkers for earlier diagnosis and effective therapeutic targets. MiRNA-324-5p has been shown to be over-expressed in GC, however the biological function of miRNA-324-5p implicated in gastric
Yin Peng et al.
Cancer letters, 385, 117-127 (2016-11-05)
Emerging evidence has shown that miRNA-194 is aberrantly upregulated in gastric cancer (GC); however, the biological mechanisms underlying its involvement are largely unknown. Wnt/β-catenin signaling has been implicated in gastric tumorigenesis; we therefore hypothesized that miRNA-194 promotes gastric carcinogenesis by
Bo Ram Kim et al.
Cell death and differentiation, 27(2), 676-694 (2019-07-07)
Disabled tumor suppressor genes and hyperactive oncogenes greatly contribute to cell fates during cancer development because of their genetic alterations such as somatic mutations. However, little is known about how tumor suppressor genes react to diverse oncogenes during tumor progression.
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
