설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCACCAAACTTCCCTGTGTTTGTGATCTTCCGCTTCCTGCAAGGTGTATTTGGAAAGGGGACGTGGATGACTTGCTACGTGATTGTGACAGAAATAGTAGGTTCGAAACAAAGGAGGATTGTGGGAATCGTGATTCAAATGTTCTTTACCCTTGGAATCATAATTCTCCCTGGAATTGCCTACTTCATCCCCAACTGGCAAGGAATCCAGTTAGCCATCACGCTGCCCAGCTTTCTCTTCCTCCTTTATTACTGGGTGGTCCCTGAGTCTCCCCGTTGGCTGATTACTCGGAAGAAAGGAGATAAAGCATTACAGATCCTGAGACGCATTGCTAAGTGCAATGGGAAATACCTCTCATCAAATTACTCAGAGATCACTGTTACAGATGAGGAAGTTAGTAATCCATCCTTTTTAGATCTGGTGAGAACTCCCCAAATGAGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SLC22A3(6581) , SLC22A3(6581)
관련 카테고리
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ji-Xian Xiong et al.
International journal of biological sciences, 14(12), 1658-1668 (2018-11-13)
Esophageal squamous cell carcinoma (ESCC) occurs with the highest frequency in China, especially in the high-risk Northern Chinese. Recent studies have reported that SLC22A3 is significantly downregulated in non-tumor (NT) esophageal tissues from familial ESCC patients compared with those from
Cheng-Ming Hsu et al.
Oncotarget, 8(43), 74348-74358 (2017-11-02)
Solute carrier family 22 member 3 (SLC22A3), also called organic cation transporter 3 (OCT3), is responsible for organic cation transport, which can eliminate many endogenous small organic cations, drugs, and toxins. This study investigated whether SLC22A3 expression is related to
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
