설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGCCTCCATTTTCCATTTGTCTTTCATCTCCATTGACCGCTACTATGCTGTGTGTGATCCACTGAGATATAAAGCCAAGATGAATATCTTGGTTATTTGTGTGATGATCTTCATTAGTTGGAGTGTCCCTGCTGTTTTTGCATTTGGAATGATCTTTCTGGAGCTAAACTTCAAAGGCGCTGAAGAGATATATTACAAACATGTTCACTGCAGAGGAGGTTGCTCTGTCTTCTTTAGCAAAATATCTGGGGTACTGACCTTTATGACTTCTTTTTATATACCTGGATCTATTATGTTATGTGTCTATTACAGAATATATCTTATCGCTAAAGAACAGGCAAGATTAATTAGTGATGCCAATCAGAAGCTCCAAATTGGATTGGAAATGAAAAATGGAATTTCACAAAGCAAAGAAAGGAAAGCTGTGAAGACATTGGGGAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TAAR1(134864) , TAAR1(134864)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Mallory S Pitts et al.
Histochemistry and cell biology, 152(2), 155-166 (2019-05-22)
Trace amine-associated receptors are G protein-coupled receptors of which TAAR1 is the most well-studied. Recently, Vattai et al. (J Cancer Res Clin Oncol 143:1637-1647 https://doi.org/10.1007/s00432-017-2420-8 , 2017) reported that expression of TAAR1 may be a marker of breast cancer (BC)
Uma Sriram et al.
Journal of leukocyte biology, 99(1), 213-223 (2015-08-26)
The novel transmembrane G protein-coupled receptor, trace amine-associated receptor 1 (TAAR1), represents a potential, direct target for drugs of abuse and monoaminergic compounds, including amphetamines. For the first time, our studies have illustrated that there is an induction of TAAR1
D Almeida-Santos et al.
Journal of molecular neuroscience : MN, 71(3), 625-637 (2020-08-21)
The choroid plexus (CP) constitutes a barrier between the blood and the cerebrospinal fluid (CSF) which regulates the exchange of substances between these two fluids through mechanisms that are not completely understood. Polyamines as spermine, spermidine and putrescine are produced
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
