콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU000321

Sigma-Aldrich

MISSION® esiRNA

targeting human THBD

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CGTGGATGACTGCATACTGGAGCCCAGTCCGTGTCCGCAGCGCTGTGTCAACACACAGGGTGGCTTCGAGTGCCACTGCTACCCTAACTACGACCTGGTGGACGGCGAGTGTGTGGAGCCCGTGGACCCGTGCTTCAGAGCCAACTGCGAGTACCAGTGCCAGCCCCTGAACCAAACTAGCTACCTCTGCGTCTGCGCCGAGGGCTTCGCGCCCATTCCCCACGAGCCGCACAGGTGCCAGATGTTTTGCAACCAGACTGCCTGTCCAGCCGACTGCGACCCCAACACCCAGGCTAGCTGTGAGTGCCCTGAAGGCTACATCCTGGACGACGGTTTCATCTGCACGGACATCGACGAGTGCGAAAACGGCGGCTTCTGCTCCGGGGTGTGCCACAACCTCCCCGGTACCTTCGAGTGCATCTGCGGGCCCGACTCGGCCCTTGCCCGCCACATTGGCACCGACTGTGACTCCGGCAAGGTGGACGGTGGCGACAGCGGCTCTGGCGAGCCCCCGCCCAGCCCGACGCCCGGCTCCACCTTGACTCCTCCGGCCGTGGGGCTCGTGCATTCGGGCTTGCTCATAGGCATCTCC

Ensembl | 인체 수납 번호

ENSG00000178726

NCBI 수납 번호

NM_000361

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... THBD(7056) , THBD(7056)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
BEV
ADV
NOU
WEU

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Tadashi Inoue et al.
Human molecular genetics, 23(21), 5672-5682 (2014-06-09)
Latent TGF-β-binding protein-2 (LTBP-2) is an extracellular matrix protein associated with microfibrils. Homozygous mutations in LTBP2 have been found in humans with genetic eye diseases such as congenital glaucoma and microspherophakia, indicating a critical role of the protein in eye
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
Chun-Te Wu et al.
BMC cancer, 14, 375-375 (2014-06-03)
The identification of potential tumor markers will help improve therapeutic planning and patient management. Thrombomodulin (TM) is a sensitive urothelial marker. TM was reported to be one of the endogenous anti-metastatic factors and has diagnostic and prognostic values for the
Elisabeth Losdyck et al.
The Journal of biological chemistry, 290(48), 29022-29034 (2015-10-09)
JAK1 and JAK3 are recurrently mutated in acute lymphoblastic leukemia. These tyrosine kinases associate with heterodimeric cytokine receptors such as IL-7 receptor or IL-9 receptor, in which JAK1 is appended to the specific chain, and JAK3 is appended to the
Minttu Kansikas et al.
Human mutation, 35(9), 1123-1127 (2014-06-14)
Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.