Recommended Products
shipped in
wet ice
storage temp.
2-8°C
1 of 4
This Item | EHU903961 | EMU147591 | EHU031881 |
---|---|---|---|
esiRNA cDNA target sequence CACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAGACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTTGTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATACTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGCATGCCAGG | esiRNA cDNA target sequence GCGTGCGCACCTTCCTGTCCTAGGCCAGGTGCCATGGCCGGCCAGGTGGGCTGCAGAGTGGGCTCCCTGCCCCTCTCTGCCTGTTCTGGACTGTGTTCTGGGCCTGCTGAGGATGGCAGAGCTGGTGTCCATCCAGCACTGACCAGCCCTGATTCCCCGACCACCGCCCAGGGTGGAGAAGGAGGCCCTTGCTTGGCGTGGGGGATGGCTTAACTGTACCTGTTTGGATGCTTCTGAATAGAAATAAAGTGGGTTTTCCCTGGAGGT | esiRNA cDNA target sequence GAAGGCTGCGGATCAACAATCAGGCGCCTCTGCTTCCAGGGCGCCGGGGGCCTGACTCGGTGGTGAGTGCGGCTGCCTTCGTCAGGACGGGCGAGCGTGGCTCTCGACGGCTGGGCGGGCTAGCTGACTCCTCCTTCGGCCCGGAAGGCAGTTCTCAGGGCCGCCCGACCCCCGCTCCCTGCCTAAGTCCTTGGGCTTGGACTTGTATAACAGTTTTGCTTTCTTTTCCTTTCGGTTTATTTTTTCAGTCAACCCAGGCTAGTCTCGAATTTGCGGCAATCCTCCTGCCTCCAATCGTTCTAGGTGCTGGGATTACTGGTGTGCAGCACCTCGGCTGTCTCTTCAGATTTTCTGCAGGTT | esiRNA cDNA target sequence TGGGAGTGACAGATGATGGAGAAGGAAGTCATATTCTTCAATCTCCATCAGCCAATGTGCTTCCAACCCTTCCTTTCCACGTCCTTCGTAGCTTGTTTAGCACTACACCTTTGACAACTGATGATGGTGTACTTCTAAGGCGGATGGCATTGGAAATTGGAGCCTTACACCTCATTCTTGTCTGTCTCTCTGCTTTGAGCCACCATTCCCCACGAGTTCCAAACTCTAGCGTGAATCAAACTGAGCCACAGGTGTCAAGCTCTCATAACCCTACATCAACAGAAGAACAACAGTTATATTGGGCCAAAGGGACTGGCTTTGGAACAGGCTCTACAGCTTCTGGGTGGGATGTGGAACAAGCCTTAACTAAGCAAAGGCTGGAAGAGGAACATGTTACCTGCCTTCTGCAGGTT |
storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
form lyophilized, lyophilized powder | form lyophilized, lyophilized powder | form lyophilized powder | form lyophilized powder |
shipped in ambient | shipped in ambient | shipped in ambient | shipped in ambient |
General description
Application
Features and Benefits
• Unique antibody affinity media – Novel high density antibody media displays higher specificity, reducing contamination and significantly improving depletion capacity compared to any currently available products
• Convenient spin-column format – Fast depletion and recovery accelerates throughput and validation making this the preferred choice for all proteomics labs
Legal Information
related product
Signal Word
Warning
Hazard Statements
Precautionary Statements
Hazard Classifications
Skin Sens. 1
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Can the Product PROT20, ProteoPrep Plasma Immunodepletion Kit, columns be re-used?
With proper cleaning and storage, each column may be reused at least 100 times.
The Product PROT20, ProteoPrep Plasma Immunodepletion Kit, bulletin indicates that 8 microliters of plasma are loaded on to the column. I have more than 8 microliters of plasma. Can I load greater than 8 microliters according to the procedure?
We optimized the protocol for dilution of about 8 microliters of plasma to 100 microliters with the 1× Equilibration Buffer. It is probably best to dilute 8 or so microliters at a time and load on the column for depletion. This process can be repeated for the full sample.
Can I use Product PROT20, ProteoPrep Plasma Immunodepletion Kit, columns on plasma from other species, e.g. monkey?
The antibodies on the PROT20 column are specific for depletion of human plasma proteins. We would not recommend this product for other species. The PROTBA is a more economical possibility to try, even though that depletes only two proteins from serum.
Are the Product PROT20, ProteoPrep Plasma Immunodepletion Kit, columns available as stand-alone products?
The columns are not available separately from the kit. The only kit components available separately are CLS8160 and M0286. We offer a smaller scale kit, PROT20S, which has one column instead of 3.
Is there a point in the protocol for Product PROT20, ProteoPrep Plasma Immunodepletion Kit, where I can stop in the middle?
In general, it is best to complete the depletion procedure once it is started. However, the customer can, if necessary, stop the procedure after the primary depletion and store the depleted samples frozen. The customer can then elute the bound proteins from the resin later and reuse it for re-depletion of the sample.
Which document(s) contains shelf-life or expiration date information for a given product?
If available for a given product, the recommended re-test date or the expiration date can be found on the Certificate of Analysis.
How do I get lot-specific information or a Certificate of Analysis?
The lot specific COA document can be found by entering the lot number above under the "Documents" section.
How do I find price and availability?
There are several ways to find pricing and availability for our products. Once you log onto our website, you will find the price and availability displayed on the product detail page. You can contact any of our Customer Sales and Service offices to receive a quote. USA customers: 1-800-325-3010 or view local office numbers.
What is the Department of Transportation shipping information for this product?
Transportation information can be found in Section 14 of the product's (M)SDS.To access the shipping information for this material, use the link on the product detail page for the product.
My question is not addressed here, how can I contact Technical Service for assistance?
Ask a Scientist here.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service