Skip to Content
Merck
All Photos(1)

Key Documents

EMU067621

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brd2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTCCCCAGCTAGTCCTCCTGGGAGTCTTGAGCCAAAGGCAGCAAGGCTCCCTCCTATGCGCAGAGAGAGTGGCCGCCCAATCAAACCCCCACGAAAAGACTTGCCTGACTCGCAACAGCAACACCAGAGCTCTAAGAAAGGGAAGCTGTCAGAGCAGTTAAAGCACTGCAACGGCATCCTGAAGGAACTGCTCTCAAAGAAGCACGCTGCCTACGCCTGGCCCTTCTATAAGCCAGTGGACGCTTCTGCTCTTGGCCTTCATGATTACCATGACATCATTAAACACCCCATGGACCTCAGCACTGTCAAGCGGAAGATGGAGAACCGTGACTACCGGGATGCACAGGAGTTTGCTGCTGATGTACGGCTTATGTTCTCCAACTGCTATAAGTACAATCCTCCAGACCACGATGTTGTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kun Zang et al.
PloS one, 8(10), e78536-e78536 (2013-11-07)
Bromodomain-containing protein 2 (Brd2) is a nuclear serine/threonine kinase involved in transcriptional regulation. In 3T3-L1 adipocytes, Brd2 normally co-represses PPARγ (peroxisome proliferator-activated receptor gamma) and inhibits adipogenesis. Here, we show that Brd2 over-expression in preadipocytes inhibits their differentiation into adipocytes
Chiara Pastori et al.
Epigenetics, 9(4), 611-620 (2014-02-06)
Epigenetic proteins have recently emerged as novel anticancer targets. Among these, bromodomain and extra terminal domain (BET) proteins recognize lysine-acetylated histones, thereby regulating gene expression. Newly described small molecules that inhibit BET proteins BRD2, BRD3, and BRD4 reduce proliferation of
Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Chang Soon Choi et al.
Neurochemical research, 40(11), 2211-2219 (2015-09-10)
The post translational modification of lysine acetylation is a key mechanism that regulates chromatin structure. Epigenetic readers, such as the BET domains, are responsible for reading histone lysine acetylation which is a hallmark of open chromatin structure, further providing a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service