Skip to Content
Merck
All Photos(1)

Key Documents

EMU011231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Il6

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₩330,484
50 μG
₩589,817

₩330,484


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₩330,484


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGGAGAGGAGACTTCACAGAGGATACCACTCCCAACAGACCTGTCTATACCACTTCACAAGTCGGAGGCTTAATTACACATGTTCTCTGGGAAATCGTGGAAATGAGAAAAGAGTTGTGCAATGGCAATTCTGATTGTATGAACAACGATGATGCACTTGCAGAAAACAATCTGAAACTTCCAGAGATACAAAGAAATGATGGATGCTACCAAACTGGATATAATCAGGAAATTTGCCTATTGAAAATTTCCTCTGGTCTTCTGGAGTACCATAGCTACCTGGAGTACATGAAGAACAACTTAAAAGATAACAAGAAAGACAAAGCCAGAGTCCTTCAGAGAGATACAGAAACTCTAATTCATATCTTCAACCAAGAGGTAAAAGATTTACATAAAATAGTCCTTCCTACCCCAATTTCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yong Xia et al.
Molecular and cellular biochemistry, 398(1-2), 147-156 (2014-09-23)
Piperine, a kind of natural alkaloid found in peppers, has been reported to exhibit anti-oxidative and anti-tumor activities, both in vitro and in vivo. Interleukin-6 (IL-6) is an important cytokine that activates the signal transduction, promotes tumor cell metastasis, and
Victoria Ingham et al.
Journal of neuroinflammation, 11, 115-115 (2014-06-24)
Activated microglia are associated with deposits of aggregated proteins within the brains of patients with Alzheimer's disease (AD), Parkinson's disease (PD) and prion diseases. Since the cytokines secreted from activated microglia are thought to contribute to the pathogenesis of these
Shijia Zhang et al.
Stem cells (Dayton, Ohio), 32(6), 1616-1628 (2014-01-23)
Adipose-derived stromal/stem cells (ASCs) have anti-inflammatory as well as immunosuppressive activities and are currently the focus of clinical trials for a number of inflammatory diseases. Acute lung injury (ALI) is an inflammatory condition of the lung for which standard treatment

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service