Skip to Content
Merck
All Photos(1)

Documents

EHU157831

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCGTTCTGTCATCTCAGCAAAGAATGGAATCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGACCAGTGTTACTTTTGGAACCCCAGAGCGCCGCAAAGGGAGTCTTGCCGATGTGGTGGACACACTGAAACAGAAGAAGCTTGAGGAAATGACTCGGACTGAACAAGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACCAGTGAACTTCTTGGAGAAATTAAAGGTACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACCATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTACTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

W-W Xu et al.
European review for medical and pharmacological sciences, 24(8), 4070-4079 (2020-05-07)
Fragile fracture patients need to be treated with long-term fixation and the recovery process is slow. Several studies have shown that the fracture healing process is related to gene expression. We aimed to investigate the role of long chain non-coding
Shifeng Long et al.
Experimental and therapeutic medicine, 17(6), 4741-4747 (2019-05-21)
Increasing evidence has revealed that microRNAs (miRNAs) are closely associated with multiple myeloma (MM) pathogenesis and progression. Therefore, an in-depth understanding of the biological functions of miRNAs in MM may be helpful for the identification of promising therapeutic techniques for
Aruna Marchetto et al.
Nature communications, 11(1), 2423-2423 (2020-05-18)
Ewing sarcoma (EwS) is an aggressive childhood cancer likely originating from mesenchymal stem cells or osteo-chondrogenic progenitors. It is characterized by fusion oncoproteins involving EWSR1 and variable members of the ETS-family of transcription factors (in 85% FLI1). EWSR1-FLI1 can induce

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service