Skip to Content
Merck
All Photos(1)

Documents

EHU143141

Sigma-Aldrich

MISSION® esiRNA

targeting human SPINT2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTCAAGAAATGTGCCACTGTCACAGAGAATGCCACGGGTGACCTGGCCACCAGCAGGAATGCAGCGGATTCCTCTGTCCCAAGTGCTCCCAGAAGGCAGGATTCTGAAGACCACTCCAGCGATATGTTCAACTATGAAGAATACTGCACCGCCAACGCAGTCACTGGGCCTTGCCGTGCATCCTTCCCACGCTGGTACTTTGACGTGGAGAGGAACTCCTGCAATAACTTCATCTATGGAGGCTGCCGGGGCAATAAGAACAGCTACCGCTCTGAGGAGGCCTGCATGCTCCGCTGCTTCCGCCAGCAGGAGAATCCTCCCCTGCCCCTTGGCTCAAAGGTGGTGGTTCTGGCGGGGCTGTTCGTGATGGTGTTGATCCTCTTCCTGGGAGCCTCCATGGTCTACCTGATCCGGGTGGCACGGAGGAACCAGGAGCGTGCCCTGCGCACCGTCTGGAGCTCCGGAGATGACAAGGAGCAGCTGGTGAAGAA

Ensembl | human accession no.

ENSG00000167642

NCBI accession no.

NM_021102

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SPINT2(10653) , SPINT2(10653)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fernanda Marconi Roversi et al.
Journal of cellular and molecular medicine, 23(2), 1562-1571 (2018-11-30)
The role of tumour microenvironment in neoplasm initiation and malignant evolution has been increasingly recognized. However, the bone marrow mesenchymal stromal cell (BMMSC) contribution to disease progression remains poorly explored. We previously reported that the expression of serine protease inhibitor
Soonyean Hwang et al.
The Journal of investigative dermatology, 135(9), 2283-2291 (2015-04-25)
Aberrant HGF-MET (hepatocyte growth factor-met proto-oncogene) signaling activation via interactions with surrounding stromal cells in tumor microenvironment has significant roles in malignant tumor progression. However, extracellular proteolytic regulation of HGF activation, which is influenced by the tumor microenvironment, and its
Chuan-Jin Wu et al.
The Journal of clinical investigation, 127(2), 623-634 (2017-01-18)
Congenital tufting enteropathy (CTE) is a severe autosomal recessive human diarrheal disorder with characteristic intestinal epithelial dysplasia. CTE can be caused by mutations in genes encoding EpCAM, a putative adhesion molecule, and HAI-2, a cell surface protease inhibitor. A similar
Chuan-Jin Wu et al.
Cells, 9(4) (2020-04-25)
The homologs EpCAM and TROP2, which both interact with claudin-1 and claudin-7, are frequently coexpressed in epithelia including skin. Intestine uniquely expresses high levels of EpCAM but not TROP2. We previously identified EpCAM as a substrate of the membrane-anchored protease

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service