Skip to Content
Merck
All Photos(1)

Key Documents

EHU137921

Sigma-Aldrich

MISSION® esiRNA

targeting human IQGAP1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₩330,484
50 μG
₩589,817

₩330,484


Estimated to ship onApril 02, 2025Details



Select a Size

Change View
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₩330,484


Estimated to ship onApril 02, 2025Details


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATTGATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTTTCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCAATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATTTGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGGTTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCTCTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTGTTTAATTAGCAATAGGGATGGTAGGATTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shihong Su et al.
DNA and cell biology, 39(7), 1127-1140 (2020-05-05)
Pulmonary microvascular endothelium barrier plays a critical role in protecting the pulmonary tissue from inflammatory injury in acute respiratory distress syndrome and acute lung injury (ARDS/ALI). The dysregulation of IQ-GTPase-activating protein 1 (IQGAP1) was an important etiology of endothelium barrier
Xiaoxia Wang et al.
The International journal of biological markers, 33(1), 73-78 (2017-07-15)
Laryngeal squamous cell carcinoma (LSCC) has a poor prognosis due to recurrence and metastasis. IQ-domain GTPase-activating protein 1 (IQGAP1), a scaffold protein, plays an important role in tumorigenesis and malignant development. In this study, we aimed to explore the role
Niramol Jitprasutwit et al.
Journal of proteome research, 15(12), 4675-4685 (2016-12-10)
Intracellular actin-based motility of the melioidosis pathogen Burkholderia pseudomallei requires the bacterial factor BimA. Located at one pole of the bacterium, BimA recruits and polymerizes cellular actin to promote bacterial motility within and between cells. Here, we describe an affinity
Bhavna Chawla et al.
The Journal of biological chemistry, 292(8), 3273-3289 (2017-01-14)
Insulin binds to the insulin receptor (IR) and induces tyrosine phosphorylation of the receptor and insulin receptor substrate-1 (IRS-1), leading to activation of the PKB/Akt and MAPK/ERK pathways. IQGAP1 is a scaffold protein that interacts with multiple binding partners and
Aaron M Tocker et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2896-2909 (2017-09-03)
Sensing of cytosolic nucleotides is a critical initial step in the elaboration of type I IFN. One of several upstream receptors, cyclic GMP-AMP synthase, binds to cytosolic DNA and generates dicyclic nucleotides that act as secondary messengers. These secondary messengers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service