Skip to Content
Merck
All Photos(1)

Key Documents

EHU133481

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM173

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₩330,484
50 μG
₩589,817

₩330,484


Estimated to ship onMay 26, 2025Details



Select a Size

Change View
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₩330,484


Estimated to ship onMay 26, 2025Details


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATATCTGCGGCTGATCCTGCCAGAGCTCCAGGCCCGGATTCGAACTTACAATCAGCATTACAACAACCTGCTACGGGGTGCAGTGAGCCAGCGGCTGTATATTCTCCTCCCATTGGACTGTGGGGTGCCTGATAACCTGAGTATGGCTGACCCCAACATTCGCTTCCTGGATAAACTGCCCCAGCAGACCGGTGACCATGCTGGCATCAAGGATCGGGTTTACAGCAACAGCATCTATGAGCTTCTGGAGAACGGGCAGCGGGCGGGCACCTGTGTCCTGGAGTACGCCACCCCCTTGCAGACTTTGTTTGCCATGTCACAATACAGTCAAGCTGGCTTTAGCCGGGAGGATAGGCTTGAGCAGGCCAAACTCTTCTGCCGGACACTTGAGGACATCCTGGCAGATGCCCCTGAGTCTCAGAACAACTGCCGCCTCATTGCCTACCAGGAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Li Zhou et al.
Cancer letters, 500, 163-171 (2020-12-06)
Although the combination of chemotherapy and immunotherapy is a hot topic in lung cancer, little is understood regarding the possible mechanisms behind their synergy. Moreover, safety is a major concern for clinicians while performing chemotherapy. Therefore, it is important to
Junxia Cui et al.
Fish & shellfish immunology, 68, 29-36 (2017-07-08)
In the innate immune responses in host protection, pattern recognition receptors are involve in a variety of sensing mechanisms to recognize and counter pathogen invasion. Recently, a resident endoplasmic reticulum adaptor, stimulator of interferon genes (STING) protein, also called MPYS
Jin-Shan Ran et al.
International journal of molecular sciences, 19(12) (2018-11-25)
Innate immunity is an essential line of defense against pathogen invasion which is gained at birth, and the mechanism involved is mainly to identify pathogen-associated molecular patterns through pattern recognition receptors. STING (stimulator of interferon genes) is a signal junction
Guigen Zhang et al.
Proceedings of the National Academy of Sciences of the United States of America, 113(8), E1034-E1043 (2016-01-27)
The latency-associated nuclear antigen (LANA) of Kaposi sarcoma herpesvirus (KSHV) is mainly localized and functions in the nucleus of latently infected cells, playing a pivotal role in the replication and maintenance of latent viral episomal DNA. In addition, N-terminally truncated
Ning Li et al.
Redox biology, 24, 101215-101215 (2019-05-24)
Mountainous evidence suggests that inflammation, cardiomyocyte apoptosis and pyroptosis are involved in the development of sepsis and sepsis-induced cardiomyopathy (SIC). Stimulator of interferon genes (STING) is an indispensable molecule that could regulate inflammation and immune response in multiple diseases. However

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service