Skip to Content
Merck
All Photos(1)

Key Documents

EHU120531

Sigma-Aldrich

MISSION® esiRNA

targeting human USP22

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₩330,484
50 μG
₩589,817

₩330,484


Estimated to ship onMarch 17, 2025Details



Select a Size

Change View
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₩330,484


Estimated to ship onMarch 17, 2025Details


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTTGCCATAGCTACCAGGAGTCCACAAAGCAGCTCACTATGAAGAAACTGCCCATCGTAGCCTGTTTTCATCTCAAACGATTTGAACACTCAGCCAAGCTGCGGCGGAAGATCACCACGTATGTGTCCTTCCCCCTGGAGCTGGACATGACCCCTTTCATGGCCTCCAGCAAAGAGAGCAGGATGAATGGACAGTACCAGCAGCCCACGGACAGTCTCAACAATGACAACAAGTATTCCCTGTTTGCTGTTGTTAACCATCAAGGGACCTTGGAGAGTGGCCACTACACCAGCTTTATCCGGCAGCACAAAGACCAGTGGTTCAAGTGTGACGATGCCATCATCACCAAGGCCAGCATCAAGGACGTCCTGGACAGCGAAGGGTACTTGCTGTTCTATCACAAACAGTTCCTGGAATACGAGTAGCCTTATCTGCAGCTGGTCAGAAAAACAAAGGCAATGCATTGGCAAGCCTCACAAAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dongyeon Kim et al.
Journal of cellular physiology, 232(12), 3664-3676 (2017-02-06)
The proto-oncogene c-Myc has a pivotal function in growth control, differentiation, and apoptosis and is frequently affected in human cancer, including breast cancer. Ubiquitin-specific protease 22 (USP22), a member of the USP family of deubiquitinating enzymes (DUBs), mediates deubiquitination of
An-Long Ji et al.
World journal of gastroenterology, 25(7), 824-836 (2019-02-28)
Intestinal ischemia reperfusion (I/R) injury is a serious but common pathophysiological process of many diseases, resulting in a high mortality rate in clinical practice. Ubiquitin-specific protease 22 (USP22) acts as regulator of cell cycle progression, proliferation, and tumor invasion. Depleted
Ying Lin et al.
Oncology letters, 20(5), 246-246 (2020-09-26)
Renal cell carcinoma (RCC) is one of the commonest urological tumors. The incidence of RCC ranks third among urological tumors, after prostate cancer and bladder tumors. However, the etiology of RCC remains unclear. Ubiquitin-specific protease 22 (USP22), a potential marker
R-Q Xin et al.
European review for medical and pharmacological sciences, 24(19), 9932-9939 (2020-10-23)
MicroRNA-329-3p (miR-329-3p) has been shown to be involved in tumor development. But its role in hepatocellular carcinoma has not been explored. Our study aims to explore the effect and mechanism of miR-329-3p on hepatocellular carcinoma development. Hepatocellular carcinoma tissues and
Gaojun Xu et al.
Experimental cell research, 362(2), 268-278 (2017-11-28)
MicroRNA-30e-5p (miR-30e-5p) is a tumor suppressor that is known to be downregulated in non-small cell lung cancer (NSCLC). However, how miR-30e-5p inhibits NSCLC tumorigenesis is not known. Ubiquitin-specific peptidase 22 (USP22) is upregulated in NSCLC and promotes tumorigenesis via a

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service