Skip to Content
Merck
All Photos(1)

Documents

EHU107751

Sigma-Aldrich

MISSION® esiRNA

targeting human PTTG1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAAGTTTCAACACCACGTTTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACTAGAAAGGCTTTGGGAACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCCCTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCAAAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTCAATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCCTTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAGCTGGGCCCCCCTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAGTCTCCTTCAAGCATTCTGTCGACCCTGGATGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lishan Cui et al.
Medical oncology (Northwood, London, England), 37(8), 73-73 (2020-07-30)
Pituitary tumor-transforming gene 1 (PTTG1) has been identified as an oncogene and is overexpressed in many tumor types. However, the role of PTTG1 in glioblastoma (GBM) has not been well characterized, especially in relation to angiogenesis, migration, and invasion. In
Emanuela Teveroni et al.
Cancers, 13(2) (2021-01-13)
(1) Background: PTTG1 sustains the invasiveness of several cancer types. We previously reported that in seminomas, PTTG1 was detected in the peripheral area of the tumor and in the leading infiltrative edge. Here, we investigate the PTTG1 role on the
Litian Yin et al.
Frontiers in pharmacology, 11, 574068-574068 (2020-12-01)
Statins, or 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibitors, have been widely used to lower cholesterol and prevent cardiovascular diseases. Recent preclinical and clinical studies have shown that statins exert beneficial effects in the management of breast cancer, while the underlying mechanisms remain

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service