Skip to Content
Merck
All Photos(1)

Key Documents

EHU074981

Sigma-Aldrich

MISSION® esiRNA

targeting human DOCK4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
₩330,484
50 μG
₩589,817

₩330,484


Estimated to ship onMay 26, 2025Details



Select a Size

Change View
20 μG
₩330,484
50 μG
₩589,817

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

₩330,484


Estimated to ship onMay 26, 2025Details


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCTTGAGCAGGCACAGATTCTGGAATTTGGTTTGGCCGTGCATGAGAAGTTTGTACCTCAAGATATGAGACCCCTTCACAAAAAGCTGGTTGACCAATTCTTTGTGATGAAGTCGAGCTTAGGGATACAGGAGTTCTCTGCTTGTATGCAAGCCAGTCCTGTCCATTTTCCTAATGGAAGCCCTCGTGTGTGTAGAAACTCAGCACCTGCTTCTGTGAGCCCAGATGGTACCAGGGTAATTCCTAGACGCAGCCCGTTAAGTTACCCAGCTGTCAACCGATATTCTTCCTCCTCACTGTCCTCACAAGCTTCTGCTGAAGTAAGCAATATTACAGGGCAATCAGAAAGCTCTGATGAAGTCTTTAACATGCAGCCAAGTCCATCTACCTCAAGCTTGAGTTCTACTCACTCGGCTTCACCTAATGTGACAAGTTCTGCTCCATCG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sriram Sundaravel et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5638-5649 (2019-07-17)
Myelodysplastic syndromes (MDS) with deletion of chromosome 7q/7 [-7/(del)7q MDS] is associated with worse outcomes and needs novel insights into pathogenesis. Reduced expression of signaling protein dedicator of cytokinesis 4 (DOCK4) in patients with -7/(del)7q MDS leads to a block
Sriram Sundaravel et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(46), E6359-E6368 (2015-11-19)
Anemia is the predominant clinical manifestation of myelodysplastic syndromes (MDS). Loss or deletion of chromosome 7 is commonly seen in MDS and leads to a poor prognosis. However, the identity of functionally relevant, dysplasia-causing, genes on 7q remains unclear. Dedicator

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service