Skip to Content
Merck
All Photos(1)

Key Documents

EHU151821

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARA

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCTCCTCGGTGACTTATCCTGTGGTCCCCGGCAGCGTGGACGAGTCTCCCAGTGGAGCATTGAACATCGAATGTAGAATCTGCGGGGACAAGGCCTCAGGCTATCATTACGGAGTCCACGCGTGTGAAGGCTGCAAGGGCTTCTTTCGGCGAACGATTCGACTCAAGCTGGTGTATGACAAGTGCGACCGCAGCTGCAAGATCCAGAAAAAGAACAGAAACAAATGCCAGTATTGTCGATTTCACAAGTGCCTTTCTGTCGGGATGTCACACAACGCGATTCGTTTTGGACGAATGCCAAGATCTGAGAAAGCAAAACTGAAAGCAGAAATTCTTACCTGTGAACATGACATAGAAGATTCTGAAACTGCAGATCTCAAATCTCTGGCCAAGAGAATCTACGAGGCC

Ensembl | human accession no.

ENSG00000186951

NCBI accession no.

NM_001001928

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PPARA(5465) , PPARA(5465)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hsu-Lung Jen et al.
Journal of atherosclerosis and thrombosis, 24(5), 508-517 (2016-09-16)
Previous studies demonstrated that endothelin-1 (ET-1) can significantly increase the cell size and stimulate adiponectin expression in cultured human cardiomyocytes (HCM). The aim of the present study was to investigate the effects of fenofibrate, a peroxisome proliferator-activated receptor-α (PPARα) activator
Tânia Vieira Madureira et al.
Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology, 229, 1-9 (2018-12-12)
The crosstalk between peroxisome proliferator-activated receptor α (PPARα) and estrogenic pathways are shared from fish to humans. Salmonid fish had an additional genome duplication, and two PPARα isoforms (PPARαBa and PPARαBb) were previously identified. Since a negative regulation between estrogen
Maja Grabacka et al.
Archives of dermatological research, 309(3), 141-157 (2017-01-14)
Recent studies revealed the cooperation between peroxisome proliferator-activated receptor gamma (PPARγ) and α-MSH signaling, which results in enhanced melanogenesis in melanocytes and melanoma cells. However, the agonists of PPARα, such as fenofibrate, exert depigmenting effect. Therefore, we aimed to check
E Di Giacomo et al.
Cell cycle (Georgetown, Tex.), 16(1), 59-72 (2016-11-20)
PPARs are a class of ligand-activated transcription factors belonging to the superfamily of receptors for steroid and thyroid hormones, retinoids and vitamin D that control the expression of a large number of genes involved in lipid and carbohydrate metabolism and
Sun Ah Ham et al.
Oncotarget, 8(55), 94091-94103 (2017-12-08)
Migration and invasion of cancer cells into surrounding tissue is a key stage of cancer metastasis. Here, we show that peroxisome proliferator-activated receptor (PPAR) δ regulates migration and invasion of human breast cancer cells via thrombospondin-1 (TSP-1) and its degrading
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service