MLTUD0610

MISSION^® Lenti microRNA Inhibitor, Mouse

mmu-miR-488-5p

• Sinonimo/i: Tough Decoy, TuD
• Codice UNSPSC: 41106609
• NACRES: NA.51

Proprietà

• Nome Commerciale: MISSION^®
• Forma fisica: liquid
• Concentrazione: ≥1x10⁶ VP/ml (via p24 assay)
• Sequenza matura: CCCAGAUAAUAGCACUCUCAA
• N° accesso Sanger maturo/minor: MIMAT0003449
• N° accesso Sanger microRNA: MI0004633
• Condizioni di spedizione: dry ice
• Temperatura di conservazione: −70°C

Descrizione

Descrizione generale

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

Allows for potent inhibition of the desired miRNA
Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
Enables long-term inhibition without repeat transfection

Altre note

Based on miRBase V19 Mature ID

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Informazioni sulla sicurezza

• Codice della classe di stoccaggio: 12 - Non Combustible Liquids
• Classe di pericolosità dell'acqua (WGK): WGK 3
• Punto d’infiammabilità (°F): Not applicable
• Punto d’infiammabilità (°C): Not applicable