HSTUD1491
MISSION® Synthetic microRNA Inhibitor, Human
hsa-miR-4484
Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
About This Item
Codice UNSPSC:
12352200
NACRES:
NA.51
Nome Commerciale
MISSION®
Stato
solid
Sequenza matura
AAAAGGCGGGAGAAGCCCCA
N° accesso Sanger maturo/minor
N° accesso Sanger microRNA
Temperatura di conservazione
−20°C
Descrizione generale
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Altre note
Based on miRBase V19
Note legali
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Avvertenze
Warning
Indicazioni di pericolo
Consigli di prudenza
Classi di pericolo
STOT RE 2 Inhalation
Organi bersaglio
Respiratory Tract
Codice della classe di stoccaggio
11 - Combustible Solids
Classe di pericolosità dell'acqua (WGK)
WGK 3
Punto d’infiammabilità (°F)
Not applicable
Punto d’infiammabilità (°C)
Not applicable
Scegli una delle versioni più recenti:
Certificati d'analisi (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.
Se ti serve aiuto, non esitare a contattarci Servizio Clienti
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..
Contatta l'Assistenza Tecnica.