HLTUD2228
MISSION® Lenti microRNA Inhibitor, Human
hsa-miR-6720-3p
Sinonimo/i:
Tough Decoy, TuD
Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
About This Item
Nome Commerciale
MISSION®
Concentrazione
≥1x106 VP/ml (via p24 assay)
tecniche
capture ELISA: 106 TU/mL using p24 (Volume 200 uL)
Sequenza matura
CGCGCCUGCAGGAACUGGUAGA
N° accesso Sanger maturo/minor
N° accesso Sanger microRNA
Condizioni di spedizione
dry ice
Temperatura di conservazione
−70°C
Descrizione generale
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Altre note
Based on miRBase V19 Mature ID
Note legali
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Certificati d'analisi (COA)
Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..
Contatta l'Assistenza Tecnica.