HLMIR0882
MISSION® Lenti microRNA, Human
hsa-miR-651-5p
Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
About This Item
Livello qualitativo
Nome Commerciale
MISSION®
Forma fisica
liquid
Concentrazione
≥1x106 VP/ml (via p24 assay)
Sequenza matura
UUUAGGAUAAGCUUGACUUUUG
N° accesso Sanger maturo/minor
N° accesso Sanger microRNA
Condizioni di spedizione
dry ice
Temperatura di conservazione
−70°C
Descrizione generale
Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
Altre note
Based on miRBase V20 Mature ID
Prodotti consigliati
Two negative controls are available: NCLMIR001 and NCLMIR002
Note legali
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Controllo
N° Catalogo
Descrizione
Determinazione del prezzo
Codice della classe di stoccaggio
12 - Non Combustible Liquids
Classe di pericolosità dell'acqua (WGK)
WGK 3
Punto d’infiammabilità (°F)
Not applicable
Punto d’infiammabilità (°C)
Not applicable
Certificati d'analisi (COA)
Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..
Contatta l'Assistenza Tecnica.