Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU077471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Thbd

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGCCAGGCTCTTACTCCTGTATGTGTGAGACAGGCTACCAGTTGGCTGCAGACGGACACCGGTGTGAGGACGTGGATGACTGTAAGCAGGGGCCCAATCCATGTCCCCAGCTCTGTGTTAACACCAAGGGCGGCTTCGAATGCTTCTGCTATGATGGCTATGAGTTGGTGGATGGAGAGTGCGTGGAGCTTCTGGATCCGTGTTTCGGATCTAACTGCGAGTTTCAGTGCCAGCCAGTGAGCCCCACCGACTACCGATGCATCTGCGCTCCAGGCTTCGCACCCAAGCCGGATGAACCGCACAAGTGCGAAATGTTCTGCAATGAAACTTCGTGCCCAGCAGACTGTGACCCTAACTCTCCTACTGTTTGTGAATGCCCTGAAGGCTTCATCCTGGACGAGGGTTCCGTATGCACGGACATTGATGAGTGCAGTCAAGGCGAATGCTTCAC

N° accesso Ensembl | topo

ENSMUSG00000074743

N° accesso NCBI

NM_009378

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... THBD(21824) , Thbd(21824)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Minttu Kansikas et al.
Human mutation, 35(9), 1123-1127 (2014-06-14)
Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene
Shahin Assefnia et al.
Oncotarget, 5(6), 1458-1474 (2014-04-01)
Cadherin-11 (CDH11), associated with epithelial to mesenchymal transformation in development, poor prognosis malignancies and cancer stem cells, is also a major therapeutic target in rheumatoid arthritis (RA). CDH11 expressing basal-like breast carcinomas and other CDH11 expressing malignancies exhibit poor prognosis.
Tadashi Inoue et al.
Human molecular genetics, 23(21), 5672-5682 (2014-06-09)
Latent TGF-β-binding protein-2 (LTBP-2) is an extracellular matrix protein associated with microfibrils. Homozygous mutations in LTBP2 have been found in humans with genetic eye diseases such as congenital glaucoma and microspherophakia, indicating a critical role of the protein in eye
Yi Liu et al.
Journal of proteomics, 106, 99-112 (2014-04-29)
Chronic hepatitis B virus (HBV) infection is a major risk factor for hepatocellular carcinoma (HCC), the sixth most common cancer worldwide. To explore potential biomarkers for HCC, iTRAQ coupled with mass spectrometry was used to analyze proteins in plasma from
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.