Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU067621

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brd2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTTCCCCAGCTAGTCCTCCTGGGAGTCTTGAGCCAAAGGCAGCAAGGCTCCCTCCTATGCGCAGAGAGAGTGGCCGCCCAATCAAACCCCCACGAAAAGACTTGCCTGACTCGCAACAGCAACACCAGAGCTCTAAGAAAGGGAAGCTGTCAGAGCAGTTAAAGCACTGCAACGGCATCCTGAAGGAACTGCTCTCAAAGAAGCACGCTGCCTACGCCTGGCCCTTCTATAAGCCAGTGGACGCTTCTGCTCTTGGCCTTCATGATTACCATGACATCATTAAACACCCCATGGACCTCAGCACTGTCAAGCGGAAGATGGAGAACCGTGACTACCGGGATGCACAGGAGTTTGCTGCTGATGTACGGCTTATGTTCTCCAACTGCTATAAGTACAATCCTCCAGACCACGATGTTGTG

N° accesso Ensembl | topo

ENSMUSG00000024335

N° accesso NCBI

NM_001025387

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... BRD2(14312) , Brd2(14312)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
BEV
BWU
AOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kun Zang et al.
PloS one, 8(10), e78536-e78536 (2013-11-07)
Bromodomain-containing protein 2 (Brd2) is a nuclear serine/threonine kinase involved in transcriptional regulation. In 3T3-L1 adipocytes, Brd2 normally co-represses PPARγ (peroxisome proliferator-activated receptor gamma) and inhibits adipogenesis. Here, we show that Brd2 over-expression in preadipocytes inhibits their differentiation into adipocytes
Chiara Pastori et al.
Epigenetics, 9(4), 611-620 (2014-02-06)
Epigenetic proteins have recently emerged as novel anticancer targets. Among these, bromodomain and extra terminal domain (BET) proteins recognize lysine-acetylated histones, thereby regulating gene expression. Newly described small molecules that inhibit BET proteins BRD2, BRD3, and BRD4 reduce proliferation of
Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Chang Soon Choi et al.
Neurochemical research, 40(11), 2211-2219 (2015-09-10)
The post translational modification of lysine acetylation is a key mechanism that regulates chromatin structure. Epigenetic readers, such as the BET domains, are responsible for reading histone lysine acetylation which is a hallmark of open chromatin structure, further providing a

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.