Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU064851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACACGCAGCTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCAGCTTATGACCACGTGCGCAAGACCAGAGTGGCCATCAAGAAGATCAGCCCCTTTGAGCATCAAACCTACTGTCAGCGCACGCTGAGGGAGATCCAGATCTTGCTGCGATTCCGCCATGAGAATGTTATAGGCATCCGAGACATCCTCAGAGCGCCCACCCTGGAAGCCATGAGAGATGTTTACATTGTTCAGGACCTCATGGAGACAGACCTGTACAAGCTGCTTAAAAGCCAGCAGCTGAGCAATGACCACATCTGCTACTTCCTCTACCAGATCCTCCGGGGCCTCAAGTATATACACTCAGCCAATGTGCTGCACCGGGACCTGAAGCCTTCCAATCTGCTTATCAACACCACCTGCGA

N° accesso Ensembl | topo

ENSMUSG00000063065

N° accesso NCBI

NM_011952

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... MAPK3(26417) , Mapk3(26417)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Michael C Brown et al.
Journal of virology, 88(22), 13149-13160 (2014-09-05)
Translation machinery is a major recipient of the principal mitogenic signaling networks involving Raf-ERK1/2 and phosphoinositol 3-kinase (PI3K)-mechanistic target of rapamycin (mTOR). Picornavirus internal ribosomal entry site (IRES)-mediated translation and cytopathogenic effects are susceptible to the status of such signaling
Tabish Hasan Khan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(7), 3644-3653 (2014-09-05)
CD40 plays dual immunoregulatory roles in Leishmania major infection and tumor regression. The functional duality emerges from CD40-induced reciprocal p38MAPK and ERK-1/2 phosphorylations. Because phosphotyrosine-based signaling in hematopoietic cells is regulated by the phosphotyrosine phosphatase SHP-1, which is not implied
Xiao-Wen Li et al.
Asian Pacific journal of tropical medicine, 8(11), 937-943 (2015-11-29)
To discuss the expression of mitogen-activated protein kinase 1 (MAPK1) in the cervical cancer and effect of MAPK1 gene silencing on epithelial-mesenchymal transition and invasion and metastasis. Immunohistochemistry, western blot and RT-PCR method were employed to detect the expression of
Juan Zhao et al.
PloS one, 9(10), e108005-e108005 (2014-10-11)
MicroRNA-21 (miR-21) plays an important role in the pathogenesis and progression of liver fibrosis. Here, we determined the serum and hepatic content of miR-21 in patients with liver cirrhosis and rats with dimethylnitrosamine-induced hepatic cirrhosis and examined the effects of
Ji Hye Kim et al.
Stem cells and development, 23(12), 1364-1376 (2014-02-15)
Although adipose-derived stem cells (ASCs) show promise for cell therapy, there is a tremendous need for developing ASC activators. In the present study, we investigated whether or not vitamin C increases the survival, proliferation, and hair-regenerative potential of ASCs. In
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.