Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU064131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Glul

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCCAGGAGAAGAAGGGCTACTTTGAAGACCGTCGGCCTTCTGCCAATTGTGACCCCTATGCGGTGACAGAAGCCATCGTCCGCACGTGTCTCCTCAACGAAACAGGCGACGAACCCTTCCAATACAAGAACTAAGTGGACTAGACTTCCAGTGATCCCTCTCCCAGCTCTTCCCTTTCCCAGTTGTCCCCACTGTAACTCAAAAGGATGGAATACCAAGGTCTTTTTATTCCTCGTGCCCAGTTAATCTTGCTTTTGTTGGTCAGAATAGAGGGGTCAGGTTCTTAATCTCTACACACCAACCCTTTCTTTCCTATCTAGCTTTCTAGTGGGGAGCGGGAGGGGGGAGGGGAAGGGTAACCCACTGCTTCATCTCATCGGGTATGCATGTCCGGTAGGCATAGCTGTCACA

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Duc Dung Le et al.
Respiratory research, 15, 73-73 (2014-07-02)
A neuroimmune crosstalk between dendritic cells (DCs) and airway nerves in the lung has recently been reported. However, the presence of DCs in airway sensory ganglia under normal and allergic conditions has not been explored so far. Therefore, this study
Vitaliy Marchenko et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 308(11), R916-R926 (2015-04-03)
While supraspinal mechanisms underlying respiratory pattern formation are well characterized, the contribution of spinal circuitry to the same remains poorly understood. In this study, we tested the hypothesis that intraspinal GABAergic circuits are involved in shaping phrenic motor output. To

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.