Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU060821

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Egr1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGGGAGAGGCAGGAAAGACATAAAAGCACAGGAGGGAAGAGATGGCCGCAAGAGGGGCCACCTCTTAGGTCAGATGGAAGATCTCAGAGCCAAGTCCTTCTACTCACGAGTAGAAGGACCGTTGGCCAACAGCCCTTTCACTTACCATCCCTGCCTCCCCCGTCCTGTTCCCCTTTTGACTTCAGCTGCCTGAAACAGCCATGTCCAAGTTCTTCACCTCTATCCAAAGGACTTGATTTGCATGGTATTGGATAAATCATTTCAGTATCCTCTCCATCACATGCCTGGCCCTTGCTCCCTTCAGCGCTAGACCATCAAGTTGGCATAAAGAAAAAAAAATGGGTTTGGGCCCTCAGAACCCTGCCCTGCATCTTTGTACAGCATCTGTGCCATGGATTTTG

N° accesso Ensembl | topo

ENSMUSG00000038418

N° accesso NCBI

NM_007913

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... EGR1(13653) , Egr1(13653)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ming Yang et al.
Breast cancer research and treatment, 158(2), 277-286 (2016-07-06)
Sulforaphene (SFE, 4-methylsufinyl-3-butenyl isothiocyanate) is a member of isothiocyanates, which is derived from radish seeds. It has shown that multiple isothiocyanates, such as sulforaphane, can effectively inhibit cancer cell proliferation in vitro and in vivo. However, it is still largely
Qiang Chen et al.
BMC molecular and cell biology, 21(1), 80-80 (2020-11-11)
Arecoline is an alkaloid natural product found in the areca nut that can induce oral submucous fibrosis and subsequent development of cancer. However, numerous studies have shown that arecoline may inhibit fibroblast proliferation and prevent collagen synthesis. High doses of
Prontip Saelee et al.
Frontiers in immunology, 8, 383-383 (2017-04-26)
The transcription factor Ets1 is highly expressed in B lymphocytes. Loss of Ets1 leads to premature B cell differentiation into antibody-secreting cells (ASCs), secretion of autoantibodies, and development of autoimmune disease. Despite the importance of Ets1 in B cell biology
Kazuhide Hayakawa et al.
Stem cell research, 12(2), 531-538 (2014-02-01)
Endothelial progenitor cells (EPCs) may contribute to neurovascular repair after stroke and neurodegeneration. A key step in this process should involve adhesive interactions between EPCs and the targeted cerebral endothelium. Here, we tested the hypothesis that reactive astrocytes may play
Sai Vikram Vemula et al.
Antiviral research, 139, 161-170 (2016-11-28)
The HIV latent CD4 Human CD4 Treatment of primary human CD4 Overall, our results offer new insights into the mechanism of action of PKC agonists, biomarkers of pathway engagement, and the potential role of EGR family in HIV reactivation.
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.