Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU036901

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Scarb1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAAATTTGGCCTGTTTGTTGGGATGAACAACTCGAATTCTGGGGTCTTCACTGTCTTCACGGGCGTCCAGAATTTCAGCAGGATCCATCTGGTGGACAAATGGAACGGACTCAGCAAGATCGATTATTGGCATTCAGAGCAGTGTAACATGATCAATGGGACTTCCGGGCAGATGTGGGCACCCTTCATGACACCCGAATCCTCGCTGGAATTCTTCAGCCCGGAGGCATGCAGGTCCATGAAGCTGACCTACAACGAATCAAGGGTGTTTGAAGGCATTCCCACGTATCGCTTCACGGCCCCCGATACTCTGTTTGCCAACGGGTCCGTCTACCCACCCAACGAAGGCTTCTGCCCATGCCGAGAGTCTGGCATTCAGAATGTCAGCACCTGCAGGTTTGGTGCGCCTCTGTTTCTCTCCCACCCCCACTTTTACAACGCCGACCCTGTGTTGTCAGAAGCTGTTCTTGGTCTGAACCCTAACCCAAAGGAGC

N° accesso Ensembl | topo

ENSMUSG00000037936

N° accesso NCBI

NM_016741

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... SCARB1(20778) , Scarb1(20778)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
JNS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Laeticia Lichtenstein et al.
Cardiovascular research, 106(2), 314-323 (2015-03-15)
High-density lipoproteins (HDLs) protect against atherosclerosis mainly due to their function in hepatobiliary reverse cholesterol transport (RCT). This is a process whereby excess cholesterol from peripheral tissues is transported by HDL particles to the liver for further metabolism and biliary
Georgia Schäfer et al.
PloS one, 4(12), e8448-e8448 (2009-12-31)
The interaction between Mycobacterium tuberculosis (Mtb) and host cells is complex and far from being understood. The role of the different receptor(s) implicated in the recognition of Mtb in particular remains poorly defined, and those that have been found to
Pin Yue et al.
PloS one, 5(3), e9906-e9906 (2010-04-03)
CD36 facilitates oxidized low density lipoprotein uptake and is implicated in development of atherosclerotic lesions. CD36 also binds unmodified high and very low density lipoproteins (HDL, VLDL) but its role in the metabolism of these particles is unclear. Several polymorphisms
Xiaoxiao Yang et al.
The Journal of biological chemistry, 290(36), 21788-21799 (2015-07-19)
The glutathione (GSH)-dependent antioxidant system has been demonstrated to inhibit atherosclerosis. Macrophage CD36 uptakes oxidized low density lipoprotein (oxLDL) thereby facilitating foam cell formation and development of atherosclerosis. It remains unknown if GSH can influence macrophage CD36 expression and cellular
Xia Chu et al.
Molecular nutrition & food research, 59(8), 1491-1503 (2015-05-07)
Ursolic acid (UA) is a triterpenoid compound with multifold biological functions. Our previous studies have reported that UA protects against high-fat diet-induced obesity and improves insulin resistance (IR). However, the potential mechanisms are still undefined. Free fatty acid (FFA) metabolism
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.